ID: 1141720960

View in Genome Browser
Species Human (GRCh38)
Location 16:85754978-85755000
Sequence TCACCTCCTAGGGGTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141720945_1141720960 19 Left 1141720945 16:85754936-85754958 CCACACCCCACTCTGCAGGGACC No data
Right 1141720960 16:85754978-85755000 TCACCTCCTAGGGGTCCTGCAGG No data
1141720942_1141720960 25 Left 1141720942 16:85754930-85754952 CCGCAGCCACACCCCACTCTGCA No data
Right 1141720960 16:85754978-85755000 TCACCTCCTAGGGGTCCTGCAGG No data
1141720948_1141720960 12 Left 1141720948 16:85754943-85754965 CCACTCTGCAGGGACCTGAGCCC No data
Right 1141720960 16:85754978-85755000 TCACCTCCTAGGGGTCCTGCAGG No data
1141720954_1141720960 -8 Left 1141720954 16:85754963-85754985 CCCGGGGGCTCCGCATCACCTCC No data
Right 1141720960 16:85754978-85755000 TCACCTCCTAGGGGTCCTGCAGG No data
1141720946_1141720960 14 Left 1141720946 16:85754941-85754963 CCCCACTCTGCAGGGACCTGAGC No data
Right 1141720960 16:85754978-85755000 TCACCTCCTAGGGGTCCTGCAGG No data
1141720953_1141720960 -2 Left 1141720953 16:85754957-85754979 CCTGAGCCCGGGGGCTCCGCATC No data
Right 1141720960 16:85754978-85755000 TCACCTCCTAGGGGTCCTGCAGG No data
1141720947_1141720960 13 Left 1141720947 16:85754942-85754964 CCCACTCTGCAGGGACCTGAGCC No data
Right 1141720960 16:85754978-85755000 TCACCTCCTAGGGGTCCTGCAGG No data
1141720941_1141720960 26 Left 1141720941 16:85754929-85754951 CCCGCAGCCACACCCCACTCTGC No data
Right 1141720960 16:85754978-85755000 TCACCTCCTAGGGGTCCTGCAGG No data
1141720940_1141720960 27 Left 1141720940 16:85754928-85754950 CCCCGCAGCCACACCCCACTCTG No data
Right 1141720960 16:85754978-85755000 TCACCTCCTAGGGGTCCTGCAGG No data
1141720955_1141720960 -9 Left 1141720955 16:85754964-85754986 CCGGGGGCTCCGCATCACCTCCT No data
Right 1141720960 16:85754978-85755000 TCACCTCCTAGGGGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141720960 Original CRISPR TCACCTCCTAGGGGTCCTGC AGG Intergenic
No off target data available for this crispr