ID: 1141721765

View in Genome Browser
Species Human (GRCh38)
Location 16:85759875-85759897
Sequence GGCATGGGCAGTGTGATCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141721754_1141721765 26 Left 1141721754 16:85759826-85759848 CCGGGAGGGCAGGATCAGCAGGT No data
Right 1141721765 16:85759875-85759897 GGCATGGGCAGTGTGATCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141721765 Original CRISPR GGCATGGGCAGTGTGATCCT CGG Intergenic
No off target data available for this crispr