ID: 1141724776

View in Genome Browser
Species Human (GRCh38)
Location 16:85780559-85780581
Sequence TGCCCCAGCCAGCGTGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 1, 2: 1, 3: 36, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141724776_1141724782 24 Left 1141724776 16:85780559-85780581 CCGTGCCCACGCTGGCTGGGGCA 0: 1
1: 1
2: 1
3: 36
4: 221
Right 1141724782 16:85780606-85780628 TGCAGAGTGGCGCGAGTGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 65
1141724776_1141724780 11 Left 1141724776 16:85780559-85780581 CCGTGCCCACGCTGGCTGGGGCA 0: 1
1: 1
2: 1
3: 36
4: 221
Right 1141724780 16:85780593-85780615 GACAGAGCCTGTATGCAGAGTGG 0: 1
1: 0
2: 0
3: 20
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141724776 Original CRISPR TGCCCCAGCCAGCGTGGGCA CGG (reversed) Intronic
900140027 1:1135957-1135979 TGCCCCAGCTCCCGTGGGCAAGG + Intergenic
900231801 1:1562780-1562802 TGCCCCACACAGGGTGGACAAGG + Intronic
900358820 1:2278201-2278223 TGCCCCACCCATCATGGGCAGGG + Intronic
900466828 1:2829856-2829878 TACCCCAGGCAGCCTGGGCCTGG - Intergenic
900606568 1:3526214-3526236 TGCCCCGGCCAGAGAGGCCAAGG + Intronic
900762654 1:4483347-4483369 AGCCCCAGCCAGTGTGGGAGTGG - Intergenic
902811838 1:18892451-18892473 TGCTTCAGCCAGGGTGGTCAGGG + Intronic
903777165 1:25800416-25800438 CGCCCCAGCCAGCTCGGGCCCGG - Intronic
904705430 1:32386790-32386812 AGCCACGGCCAGCGTGGTCAAGG - Exonic
905772890 1:40649779-40649801 TGGCCCACTCAGCCTGGGCAAGG + Intronic
906764923 1:48420212-48420234 TGGCTCATCCAGGGTGGGCATGG + Intronic
907402035 1:54230174-54230196 TCCCCCAGTCTGGGTGGGCACGG - Intronic
907834177 1:58093585-58093607 TGGACCAGGCAGGGTGGGCAGGG - Intronic
908817822 1:68051881-68051903 TGCCCCAGCCAGCTGAGGCCAGG + Intergenic
912373356 1:109190749-109190771 TACCCCAGCCCGCTTGGGCATGG + Intronic
912717110 1:111990360-111990382 TGTGCCAGCGAGGGTGGGCACGG + Intergenic
913091457 1:115479185-115479207 TGACCCAGCCTGGGTGGGAAGGG + Intergenic
913532634 1:119743485-119743507 TGCCCCAGTCAGCTGGGGCTTGG + Intronic
917413561 1:174784497-174784519 TACCCCAGCAAGCGTGGGACTGG + Intronic
918113898 1:181481673-181481695 TGCCCCAGCTAGTGTGGACATGG + Intronic
918857676 1:189779880-189779902 TGCCCCTGGCAGTGTGGGAAGGG - Intergenic
920166108 1:204037174-204037196 TTCCTCAGCCAGCAGGGGCAAGG - Intergenic
920329062 1:205191937-205191959 TCCTCCAGCCAGAGTTGGCAGGG - Intronic
920404219 1:205697076-205697098 TGCCTCCTCCAGAGTGGGCATGG - Intergenic
920533768 1:206723888-206723910 TGCCCCTGCCACAGTTGGCAGGG + Intronic
920561665 1:206943086-206943108 AGCCCCAGCCACCCTGGGCTGGG - Intronic
921099511 1:211916271-211916293 TCTTGCAGCCAGCGTGGGCAAGG + Intergenic
922137041 1:222839348-222839370 TTCCACAGACAACGTGGGCAGGG - Intergenic
922211488 1:223490091-223490113 AGACCCAGGCAGGGTGGGCAGGG + Intergenic
923033305 1:230266704-230266726 GTCCCCATCCAGCATGGGCATGG + Intronic
1066168037 10:32808883-32808905 TGCCCAACCCAGGGTAGGCATGG + Intronic
1067081538 10:43215262-43215284 TGCCTCTGCCAGCCTTGGCAGGG + Intronic
1067243140 10:44513342-44513364 AGCCCTAGCAAGGGTGGGCATGG + Intergenic
1067763486 10:49068467-49068489 TGCCTCAGCAAGCGCTGGCAGGG - Intronic
1068545023 10:58335267-58335289 TGGCCGAGTCAGCGTGGGCAGGG - Intronic
1069662276 10:70131740-70131762 AGCCCCAGCCAGGGTGGGCTGGG - Intronic
1069894594 10:71672641-71672663 TGCCCAGTCCAACGTGGGCAGGG + Intronic
1070592987 10:77813395-77813417 TGCCCCAGCCCTCTTGGGAAGGG + Intronic
1070593877 10:77819261-77819283 TGCCCAAGCCTGCCTGGACATGG - Intronic
1072613482 10:97034639-97034661 TTCCCCAGCCAGGTTGGCCAGGG + Intronic
1073424638 10:103449051-103449073 TACCCCAGCCAGATTGAGCATGG - Intronic
1076280477 10:129242333-129242355 AGCCCAGGCCAACGTGGGCAGGG - Intergenic
1077358885 11:2131010-2131032 TGGCCCAGCCAGAGTGAGGAAGG - Intronic
1079401529 11:20110088-20110110 GGCCCCAGCCATCTGGGGCAGGG + Intronic
1081814095 11:45929020-45929042 TGCCCCAGCCAGTTTGGGGCTGG + Exonic
1082000145 11:47389715-47389737 TGCCCCAGCCCCAGTGGCCAGGG + Intergenic
1082996903 11:59262201-59262223 AGGCCCAGCCAGCGTGGCCCTGG - Intergenic
1083723035 11:64612770-64612792 TGCCCCTCACAGCCTGGGCAGGG - Intronic
1083877118 11:65530155-65530177 TGCCCAATCCAGCCAGGGCAGGG + Intronic
1083903377 11:65654735-65654757 TTCCCCAGCCTGGGTGGGCTTGG + Exonic
1084408199 11:68991168-68991190 TGCCCAAGCCCGCCTGGGAAGGG - Intergenic
1084630605 11:70346152-70346174 AGGCCAAGCCAGCGTGGGCAGGG - Intronic
1084742088 11:71146524-71146546 GGACACAGCCAGCGTGGGCCAGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1089443334 11:118533320-118533342 GTCCCCAGCCACCCTGGGCAAGG + Intronic
1089588437 11:119524561-119524583 TGTCCCGGCCAGCAGGGGCAAGG + Intergenic
1091108584 11:132944331-132944353 TGCCCCATCTGGCGTGGGCAGGG - Intronic
1091383260 12:76639-76661 TGCTCCAGACAGAGTGGGTATGG - Intronic
1091795289 12:3294493-3294515 TGCCAGAGCCAGCCTGGGCAGGG - Intergenic
1092335487 12:7629073-7629095 AGACCCAGCCAGAGTGGACAGGG - Intergenic
1092446680 12:8564507-8564529 AGACCCAGCCAGAGTGGACAGGG + Intergenic
1096186589 12:49585699-49585721 TGCGCCAGACAGCATGGCCAGGG + Intronic
1096366976 12:51036257-51036279 TTCCCCACCCAGCTTTGGCAGGG - Intergenic
1097916357 12:65024400-65024422 GGCCTCAGCCAGGGTGGGCAGGG - Intergenic
1098235733 12:68416498-68416520 TGCCCCATCCAGCTTGTGCGGGG - Intergenic
1099222939 12:79935324-79935346 TGGCCCAGGCAGCGGGGGCTGGG + Intronic
1102037475 12:109780359-109780381 TCCCCCAGGCAGGCTGGGCACGG - Intergenic
1102572522 12:113835709-113835731 TGCCCAAGCCAGGTTGGGCTGGG - Intronic
1103226814 12:119294997-119295019 TGCCCCACCCAGCGTAGCTACGG + Intergenic
1105471995 13:20703494-20703516 CGCCCCAGCCAGCCCGCGCAGGG - Intronic
1106760053 13:32859207-32859229 TGCCCCTGGCACCGTGGGCCTGG + Intergenic
1106923390 13:34588573-34588595 TGCCCCGCCAGGCGTGGGCAGGG + Intergenic
1108707964 13:53007063-53007085 TACCCAGGCCAGCCTGGGCAGGG + Intergenic
1109792123 13:67262752-67262774 TGCCCTAGCCAGAGTGGGGAGGG - Intergenic
1110219596 13:73059258-73059280 GACCCAAGCCAGCGTGGGCGAGG + Exonic
1113460682 13:110479896-110479918 TGCCCCAGCCAGAGCTGGCAAGG + Intronic
1114195070 14:20469701-20469723 TGCGGCAGCCAGCGCGGGCAGGG + Intronic
1115096959 14:29648942-29648964 AGCCCCAGCCAGGCCGGGCATGG - Intronic
1118259712 14:64235617-64235639 TGCCGCAGCCAGCCATGGCAGGG + Intronic
1119357425 14:74018976-74018998 TGCCGCAGCCAGCGTGGCCGCGG - Intronic
1119644434 14:76338271-76338293 GGCTCCAGCCCGGGTGGGCATGG + Intronic
1119753011 14:77093826-77093848 GGCTCCAGCCTGTGTGGGCAGGG - Intergenic
1119898740 14:78242646-78242668 TGCCCCAGCCAGGGAGGCCAGGG - Intronic
1122252448 14:100449458-100449480 TGCAACAGCCAGCCAGGGCAGGG - Intronic
1122302315 14:100738290-100738312 GGCCCCGGGCAGGGTGGGCAGGG + Intergenic
1122787158 14:104169054-104169076 TGCCCCAGCCAGCCAGGCCTGGG - Intronic
1122959627 14:105088451-105088473 GGCCCCAGCCAGCGGGGCCGAGG + Intergenic
1125672070 15:41480894-41480916 GGCCCCACCCAGTGTGGGCCTGG + Exonic
1126111200 15:45175670-45175692 TGCAACAGCCAGCGAGGGCTGGG + Intronic
1126142347 15:45448712-45448734 GGCCCCAGACAACGTGGGCAGGG - Intronic
1127332168 15:57949983-57950005 TGGCACAGACAGCGTGGTCAGGG + Intergenic
1128904811 15:71457431-71457453 AGCCCCAGCCAGAATGGGCAAGG - Intronic
1131112725 15:89775853-89775875 TTCCTCAGCCACCATGGGCAGGG + Intronic
1132203524 15:99971058-99971080 CTCTCCAGCCAGCGTGGCCAGGG + Intergenic
1132850999 16:2025051-2025073 TGCCCCACCCAGGGCGGGTAAGG + Intergenic
1133101824 16:3484645-3484667 TGCCCTGGCGAGCGTGGTCAGGG + Intronic
1134246991 16:12547445-12547467 TGCCTCAGGCAGCCTGGGAAGGG + Intronic
1135524784 16:23205937-23205959 TCCCCCAGCCACTGAGGGCATGG - Intronic
1136227188 16:28866883-28866905 TGACCCAGCCGGAGTGGGCCGGG + Exonic
1136479572 16:30533203-30533225 TCCCACAGCCCGCGTGGACAGGG + Intronic
1136483349 16:30556162-30556184 TCCCACAGCCCGCGTGGACAGGG + Intronic
1136585617 16:31182523-31182545 TACCCCACCCAGCCCGGGCAGGG + Exonic
1137000444 16:35225186-35225208 TGCAGCAGCCAGCCTGGGCGAGG + Intergenic
1139955786 16:70692370-70692392 TGCCACAGACAGGGTGGGGAGGG + Intronic
1140410460 16:74737847-74737869 TGACCCAGGCAGCGGGGGCTGGG - Intronic
1140482212 16:75267701-75267723 TGCCCCAGCCAGAATGGGGCGGG + Intronic
1141724776 16:85780559-85780581 TGCCCCAGCCAGCGTGGGCACGG - Intronic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1142226634 16:88880849-88880871 GGGCCCAGCCAGGGTGGGGAGGG - Intronic
1142230039 16:88895794-88895816 TCCCCCAGCCCTCGAGGGCAGGG - Intronic
1142230249 16:88896785-88896807 CGCCCCGGCCAGCCTGGGCCTGG + Intronic
1142277921 16:89132668-89132690 TGCCCCAGCCCCTGTGGGCAAGG + Intronic
1143037289 17:4006645-4006667 TGCCTCAGAAAGGGTGGGCAGGG - Exonic
1143280176 17:5748045-5748067 TTCACCAGCCAGGGAGGGCATGG + Intergenic
1143450885 17:7036160-7036182 TGGCCCGGCCAGCGCGGGCCAGG + Exonic
1144782931 17:17816926-17816948 TGGCCCCGGCAGAGTGGGCAGGG - Intronic
1146686001 17:34842000-34842022 TGACCCAGCCTCCGTGGGCCTGG - Intergenic
1147211243 17:38873751-38873773 TGCCCCGGCCAGGGTGGGGCTGG + Intronic
1148785760 17:50145492-50145514 AGCTCCAACCAGCGTGAGCATGG + Intronic
1156482538 18:37445279-37445301 TGCCCCAGAGAGCGCGGCCAGGG + Intronic
1160844613 19:1160941-1160963 GGCCCCTCCCAGGGTGGGCAGGG + Intronic
1161028828 19:2048735-2048757 TGCCCGAGCCAGGGTGGGTGGGG - Intronic
1161535896 19:4818259-4818281 TGCCCCTGGCAGCCTGGGCGTGG + Exonic
1161575236 19:5051292-5051314 TTTCCCAGGCAGCGTGGGCCAGG - Intronic
1161680735 19:5678509-5678531 TGCCCCGGCCAGAACGGGCAGGG - Exonic
1161746505 19:6063470-6063492 TGCACCTGCCAGGGTGGGGATGG + Intronic
1161839427 19:6670066-6670088 TGCTCCAGACACCTTGGGCATGG - Exonic
1162063492 19:8110990-8111012 TGCCCCACCCAGAGTCTGCAGGG + Intronic
1163188068 19:15653557-15653579 AGTCCCAGCCCACGTGGGCAGGG + Intronic
1163560593 19:18017166-18017188 TGTCCCAGCCAGCCTGCCCAAGG + Intergenic
1163690533 19:18736095-18736117 GGTTCCAGCCAGCGTGGACATGG + Intronic
1163795172 19:19333840-19333862 AGCCCCAGCCTGGGTGAGCAAGG - Intronic
1165527786 19:36370619-36370641 TGCACCAGCCAGAGTGGCCCTGG + Intronic
1166050723 19:40257222-40257244 TGCCCCAGCCTGCGTCAGCAGGG - Intronic
1166738814 19:45102026-45102048 TCCCCCAGCCAGCGTGTCCTTGG + Intronic
1166931826 19:46305596-46305618 TGACCCAGCCTGAGTGGGAATGG + Intronic
1168398137 19:56066278-56066300 TGCACCAGGCAGCGGGGGCCTGG - Intergenic
925040792 2:731875-731897 GGCCCCAGCCTGGGTGGCCAGGG - Intergenic
928175126 2:29028236-29028258 TCACCCATCCAGGGTGGGCATGG - Intronic
928209309 2:29311935-29311957 CTCCCCAGCCAGCATGGGCATGG - Intronic
929811340 2:45191431-45191453 TTGCCCGGCCAGAGTGGGCAGGG + Intergenic
931996336 2:67842574-67842596 TGACCCAGCCAGCATGAGCCAGG - Intergenic
934119170 2:88823725-88823747 TTCCCCAGGCAGGGTGGCCAGGG + Intergenic
937880430 2:126860267-126860289 TGCCACAGCCAGTGTGTGCCAGG - Intergenic
942193978 2:173498791-173498813 TGCTCCAGCCAGCATGGAAAGGG + Intergenic
942251593 2:174051877-174051899 GGCCCCACCCAGCTTGGGCCAGG - Intergenic
946335444 2:219032439-219032461 TGCCACAGCGAGTGAGGGCAGGG - Intronic
946400953 2:219468272-219468294 TGCTTCATCCAGGGTGGGCAGGG + Intronic
947639237 2:231697040-231697062 TGCCCCAGCCACAGTGGGACAGG - Intergenic
948424108 2:237876983-237877005 TGCCCGTGCCAGCTTGGGCCAGG - Intronic
948806771 2:240456456-240456478 TGGCCCAGCCAGCCTGGCCTGGG + Intronic
948869340 2:240790417-240790439 TTCCTCAGCCAGCGTGGGCTGGG + Intronic
948890435 2:240904743-240904765 TGCCTCAGCCTGAGTGGGGAGGG - Intergenic
1168763154 20:363423-363445 TGACTCAGCCAGTGTGAGCAGGG + Intronic
1172744319 20:37194801-37194823 GGCCCCAGCCAGTGTGTGCCTGG + Intronic
1173638374 20:44581024-44581046 TGCCGCAGCCAGCCTGGGAAAGG - Intronic
1175544744 20:59771031-59771053 CGCCCCACCCAGCTTGTGCAGGG - Intronic
1175920882 20:62450212-62450234 AGCCCCAGGCAGCGTGGCCGGGG - Intergenic
1176125876 20:63474396-63474418 GGCACCAGCCAGCGTGTGCAGGG - Intergenic
1176281919 20:64318148-64318170 TGCTCCAGACAGAGTGGGTATGG + Intergenic
1176363436 21:6017597-6017619 TGACCAAGCCAGAATGGGCAGGG + Intergenic
1176363755 21:6020063-6020085 GGCTCTAGCCAGCCTGGGCATGG - Intergenic
1176431444 21:6578761-6578783 TCCCACAGAGAGCGTGGGCAAGG + Intergenic
1179017105 21:37603416-37603438 TGCCCCTGCCAGCCTTGGCAGGG + Intergenic
1179706838 21:43186223-43186245 TCCCACAGAGAGCGTGGGCAAGG + Intergenic
1179759763 21:43518482-43518504 GGCTCTAGCCAGCCTGGGCATGG + Intergenic
1179760082 21:43520948-43520970 TGACCAAGCCAGAATGGGCAGGG - Intergenic
1180226827 21:46398527-46398549 TGTCACAGCCAGTATGGGCAGGG + Intronic
1181052935 22:20246260-20246282 TGCGGCAGCCAGACTGGGCAGGG + Intronic
1182368283 22:29793196-29793218 TGCCCCATTCAGGGTGGGCTGGG + Intronic
1183742422 22:39676176-39676198 TGCCCCCGCCGGCCTGTGCAGGG + Intronic
1183903591 22:41023374-41023396 TGTCCCAGAAAGCATGGGCACGG - Intergenic
1185056941 22:48586080-48586102 AGGCCCAGCCAGCGAGGGCCAGG - Intronic
1185066735 22:48636018-48636040 TGCACCTGCAAACGTGGGCAGGG - Intronic
1185315919 22:50179052-50179074 GACACCAGCCAGCCTGGGCAAGG + Exonic
949859448 3:8492175-8492197 TGCCCAACCCAGCGAGGGGAAGG + Intergenic
950645545 3:14374552-14374574 TGCCCCTGCCAGGATGGGCAGGG + Intergenic
950941658 3:16898896-16898918 GGCCCCAGCCAGCTGTGGCAGGG + Intronic
951939926 3:28066247-28066269 TGCCCCTGCCTGAGTGGACATGG - Intergenic
952898883 3:38096755-38096777 TGCCTCGGCCAGCCTAGGCAGGG - Intronic
953421146 3:42754236-42754258 TGCTCCTGCCAGCCTGGGCGAGG + Intronic
954616968 3:51974054-51974076 GGCCCCATCCAGCGGGGGCGGGG + Exonic
954762857 3:52889623-52889645 TGCCCAAGCCTGGGTGAGCACGG + Intronic
955536061 3:59924928-59924950 TGCTTCTGCCAGTGTGGGCACGG + Intronic
956681690 3:71786744-71786766 TTCCCGAGCTAGCGTTGGCATGG - Intergenic
956738239 3:72255544-72255566 TGCCCCAGCAGGCTTGGGGAGGG - Intergenic
959094271 3:101936352-101936374 AGACCCAGCCAGGCTGGGCACGG + Intergenic
968067480 3:195766697-195766719 TGTCCCAGCCAGTGTGGGAGAGG - Exonic
968866044 4:3212585-3212607 GGCCCGGGCCAGAGTGGGCAGGG - Exonic
969449963 4:7267422-7267444 CGCCCCAGCCTGCTTGGGTAGGG - Intronic
969497706 4:7535395-7535417 TGCCCCAGCCAGAGAAGCCAGGG - Intronic
969601525 4:8179339-8179361 TGCACCTTCCAGCGAGGGCATGG - Intergenic
969694431 4:8726548-8726570 TGCCCCAGCCAGCCTGAGCCTGG - Intergenic
969717234 4:8873590-8873612 TACCCCAGCCAGAGGGGGCTGGG + Intergenic
975665955 4:76735349-76735371 TTCCCCAGGCAGCTTGGGAATGG + Intronic
984709841 4:182875841-182875863 TGCACCAGGCAGGGAGGGCAGGG + Intergenic
985629400 5:1006918-1006940 TGCCCCAGCCAGGTGGGGAAGGG - Intergenic
985675413 5:1229011-1229033 TTCCCCGGCCTGCGTGGGCACGG - Intronic
988480559 5:31626964-31626986 TGCCACATCTAGCGAGGGCAGGG + Intergenic
990519205 5:56561698-56561720 TTCACCAGCAAGTGTGGGCAAGG + Intronic
994017913 5:94989894-94989916 TGTCACAGCCAGAGAGGGCATGG + Intronic
994353807 5:98773731-98773753 GGCCCCAGCCAGCGTGGGCTCGG - Intronic
997346499 5:133196163-133196185 AGCCCCAGGCAGGGTGGGCTGGG + Intergenic
998192777 5:140041944-140041966 AGACCCTGCCAGCCTGGGCACGG + Intronic
1000212491 5:159120098-159120120 TGCCCAAGCCAGCAGTGGCAAGG + Intergenic
1001094029 5:168762467-168762489 ACCCGGAGCCAGCGTGGGCAGGG - Intronic
1001822498 5:174721089-174721111 TGCCCCGGGCAGCGGGGGCGGGG + Intergenic
1002861950 6:1087187-1087209 TGCCACAGCAAGTGTGGACAAGG - Intergenic
1003550951 6:7101556-7101578 CACTCCAGCCAGAGTGGGCAGGG - Intergenic
1005849007 6:29804768-29804790 TGCACCAGCCAGTGTGCTCAGGG + Intergenic
1010480197 6:76342539-76342561 TGTCCCAGCCTGTGTGGGCTTGG + Intergenic
1011744567 6:90397039-90397061 TGGCCCAGGCATGGTGGGCAGGG + Intergenic
1012247664 6:96943782-96943804 TGCCCCAGCCATCTGGGGAAGGG + Intronic
1016017903 6:139204932-139204954 TGCCACAGCCACTGTGGGGATGG - Intergenic
1018742935 6:166744306-166744328 GGCCTCGGCCAGCGTGTGCAGGG + Intronic
1019173438 6:170147597-170147619 TCTCCCAGCCAGCGTGCGCATGG + Intergenic
1019517013 7:1444588-1444610 TGCACCAGCCAGCGGGGCCCCGG - Intronic
1019633944 7:2065486-2065508 TGCCCCAGGCAGCGAGGACGTGG + Intronic
1019697133 7:2452171-2452193 GGCCTCAGCCAGCGTGGTCCTGG - Intergenic
1023609810 7:41961366-41961388 TGCACCAGCCAGAGAGCGCACGG - Exonic
1026768022 7:73172660-73172682 TGCCCCAGCCACCGAGGGCTTGG + Intergenic
1027044488 7:74982370-74982392 TGCCCCAGCCACCCAGGGCTTGG + Intronic
1027079151 7:75219990-75220012 TGCCCCAGCCACCGAGGGCTTGG - Intergenic
1029129195 7:98317477-98317499 GGCCCCAGCCAGTGTGAGGATGG - Intronic
1029388382 7:100258569-100258591 TGCCCCAGCCACCCAGGGCTTGG - Intronic
1033368569 7:140689629-140689651 TGCCCGGGCCAGCGAGTGCAGGG + Exonic
1034996993 7:155583932-155583954 AGCCCCAGCCTGGGAGGGCATGG + Intergenic
1035278586 7:157763379-157763401 TGCCCCAGTCACTGTGGCCATGG + Intronic
1036730457 8:11258641-11258663 TGGCCCAGACACAGTGGGCATGG + Intergenic
1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG + Intronic
1037819219 8:22127633-22127655 TGCCCCAGGAAGAGCGGGCAAGG + Exonic
1039050017 8:33484657-33484679 TGCCGCACCCAACGTGGGCGTGG + Intronic
1039983279 8:42427284-42427306 TGCCCCAGGCACCTTGGCCATGG + Intronic
1040564391 8:48552964-48552986 AGCACCAGGCAGAGTGGGCAAGG + Intergenic
1042091714 8:65166021-65166043 TGTCCCAGCCACCTTTGGCAAGG - Intergenic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1045051238 8:98327749-98327771 AGCCCCAGGCAGCTTAGGCAGGG + Intergenic
1045141667 8:99292217-99292239 TGCCTCAGCCAGCCTGTGAAAGG + Intronic
1046937259 8:119896433-119896455 TGCCCCAGCTATTGTGGACATGG + Intronic
1047765010 8:127983219-127983241 TGGCCCTGCCAGCCTGGCCATGG + Intergenic
1048504424 8:135007957-135007979 TCCCACAGCCAGAGTGGGAATGG - Intergenic
1049427168 8:142542671-142542693 CACCCCAGCCAGCGAGGGCAGGG + Intronic
1049473048 8:142784731-142784753 TGCCCCTTCCAGGGTGGGGACGG + Intergenic
1051088403 9:13378822-13378844 TGCCACACCCAGGCTGGGCATGG + Intergenic
1051367306 9:16330088-16330110 TGCCCCACCCTGCGTGGGAAGGG - Intergenic
1051894712 9:21975132-21975154 CGCCAGAGCCAGCGTTGGCAAGG + Intronic
1056754576 9:89373710-89373732 TCCCCCAGCCACCCAGGGCAGGG - Intronic
1057132395 9:92663341-92663363 TGCCCCACACAGCCTGGGCATGG + Intronic
1061464364 9:130766214-130766236 TGCCCCCGCCAGCCTGCTCAGGG + Intronic
1062468535 9:136692068-136692090 AACCCCAGCAAGCGGGGGCAGGG + Intergenic
1062514642 9:136926457-136926479 TCCCACAGCCAGCCTGGCCAAGG - Exonic
1186517459 X:10176608-10176630 GTCCCCTGCCAGCGTGGGCAGGG - Intronic
1187488234 X:19724918-19724940 ATCCCCAGGCAGCGTGGGCAGGG - Intronic
1187966764 X:24619789-24619811 TGCCCCAGGCAGCTTGGGCTGGG + Intronic
1189219157 X:39356278-39356300 TGTCTCTGCCAGTGTGGGCAGGG + Intergenic
1192361824 X:70445374-70445396 GGCCCCCGCCTGCGAGGGCAAGG - Exonic
1195320645 X:103719119-103719141 TGCCCCTGCCCGTGTGGGCCTGG - Exonic
1198468067 X:136921372-136921394 TGCCTCAGCCAGCGCAGGAAGGG - Intergenic
1199992447 X:152994838-152994860 TGCTCCACACAGCCTGGGCAGGG - Intergenic