ID: 1141725836

View in Genome Browser
Species Human (GRCh38)
Location 16:85787787-85787809
Sequence CAGGCACAGGATCCTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 322}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141725836_1141725850 22 Left 1141725836 16:85787787-85787809 CCTCCCTCAGGATCCTGTGCCTG 0: 1
1: 0
2: 2
3: 35
4: 322
Right 1141725850 16:85787832-85787854 ATAATTATGTTTCTAAATTTGGG 0: 1
1: 0
2: 9
3: 117
4: 934
1141725836_1141725849 21 Left 1141725836 16:85787787-85787809 CCTCCCTCAGGATCCTGTGCCTG 0: 1
1: 0
2: 2
3: 35
4: 322
Right 1141725849 16:85787831-85787853 GATAATTATGTTTCTAAATTTGG 0: 1
1: 0
2: 1
3: 62
4: 501
1141725836_1141725841 -6 Left 1141725836 16:85787787-85787809 CCTCCCTCAGGATCCTGTGCCTG 0: 1
1: 0
2: 2
3: 35
4: 322
Right 1141725841 16:85787804-85787826 TGCCTGGACCCAGCCCTCCTAGG 0: 1
1: 0
2: 5
3: 49
4: 376
1141725836_1141725842 -5 Left 1141725836 16:85787787-85787809 CCTCCCTCAGGATCCTGTGCCTG 0: 1
1: 0
2: 2
3: 35
4: 322
Right 1141725842 16:85787805-85787827 GCCTGGACCCAGCCCTCCTAGGG 0: 1
1: 0
2: 1
3: 37
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141725836 Original CRISPR CAGGCACAGGATCCTGAGGG AGG (reversed) Intronic
900598192 1:3491869-3491891 CAGCCTCAGGGTCCTGAAGGTGG + Intronic
901665823 1:10825681-10825703 CAGGCACATGATCATGGGGCTGG + Intergenic
901971741 1:12913818-12913840 CAGACACTTGATGCTGAGGGAGG - Intronic
902013427 1:13287922-13287944 CAGACACTTGATGCTGAGGGAGG + Intergenic
903237299 1:21958316-21958338 CAGGCTCAGCAGCCAGAGGGTGG - Intergenic
903276042 1:22222541-22222563 AGGGCCCAGGAACCTGAGGGTGG + Intergenic
903418487 1:23201206-23201228 CAGGCCAAGGGTCCTGAGGCTGG + Intergenic
903502118 1:23806467-23806489 CAGGCGCAGAGCCCTGAGGGAGG - Intronic
904462255 1:30687023-30687045 CAGGCAAAGGAGGCTGAGGAGGG - Intergenic
904928859 1:34070383-34070405 CAGCCACAGGAGCCTGTGGAGGG - Intronic
905471652 1:38196658-38196680 CAGGGACAGCCTGCTGAGGGAGG + Intergenic
905506791 1:38486248-38486270 CAGGCAGAGGCTGCTGAGGTGGG - Intergenic
905610967 1:39351112-39351134 CATGCACAGAATCATGAGGAAGG + Intronic
905865519 1:41374311-41374333 CAGGGTCAGTCTCCTGAGGGAGG + Intronic
906888661 1:49682290-49682312 CAGGTACAGGAGGCTGAGGCAGG + Intronic
907242381 1:53087954-53087976 CAGGGGCAGGGTCCTGAGGCAGG - Exonic
909351030 1:74653521-74653543 CAGGCACTGAATCCTGAGCTGGG + Intronic
915193228 1:154169389-154169411 CAGGCACAGGAACCACAGGGAGG + Intronic
916462911 1:165045494-165045516 AAAGCACAGGATGTTGAGGGTGG + Intergenic
917337302 1:173938776-173938798 CTGTCAGAGGACCCTGAGGGAGG - Exonic
917966514 1:180182479-180182501 CAGGCCCAGGCTCCTGACGGTGG - Intronic
920812403 1:209299055-209299077 CAGGCACACAAAGCTGAGGGAGG - Intergenic
921333842 1:214066419-214066441 CAGAAACAGGATTCTGAGAGTGG - Intergenic
921360840 1:214329836-214329858 CAGGCAGAGGCAGCTGAGGGAGG + Intronic
921861501 1:220046582-220046604 CAGGCTCTGGAACCTGCGGGCGG - Exonic
922187497 1:223288460-223288482 CAGGAACTGAATCCTAAGGGAGG + Intronic
924636730 1:245795225-245795247 CAGACACAGGATCCTGACCAGGG - Intronic
924740148 1:246790152-246790174 CAGGGACAGGAGGCCGAGGGAGG + Intergenic
924800889 1:247329250-247329272 CGGGCGCAGGAGCCTGAGAGCGG - Exonic
1062923251 10:1295950-1295972 CAACCACAGGCTCCTGAGTGAGG - Intronic
1063444784 10:6104921-6104943 TGGGAACAGGATCCTGAGGAAGG - Exonic
1065714925 10:28557176-28557198 CTGGCACAGGAACCTGAGTCAGG - Intronic
1067064072 10:43093882-43093904 CAGGCGCAGGCTCCTGCTGGTGG + Intronic
1067234526 10:44436806-44436828 CAGGAACAAGGTCCTGAGGCAGG - Intergenic
1067436934 10:46284906-46284928 CAGGCCCAGGAGCCAGAGGGCGG - Intergenic
1070409189 10:76123763-76123785 AAGGCACAGGATCCTGGCTGAGG + Intronic
1071456797 10:85857365-85857387 CAGGCTCAGCCTCCTGAGTGTGG + Intronic
1072604819 10:96971587-96971609 CAGGGACAGGGTGCTGAGGAGGG + Intronic
1073326411 10:102646114-102646136 CAGGCCCAGAGGCCTGAGGGGGG - Intronic
1073942022 10:108710458-108710480 GAAACACAGGATCCTGAAGGTGG - Intergenic
1075831396 10:125414582-125414604 CAGGCACTGGACCATGATGGGGG + Intergenic
1075898599 10:126019786-126019808 CAGGCAGAGGCTTCTGAGGGGGG + Exonic
1076396470 10:130141866-130141888 TGGGCAGAGGCTCCTGAGGGAGG + Intronic
1076441632 10:130484655-130484677 CTGGCCCAGGCTGCTGAGGGAGG + Intergenic
1076806032 10:132859235-132859257 CAGGCTCAGGCACCTGACGGAGG + Exonic
1077214988 11:1391458-1391480 CAGGCCCAGGCTCTTGGGGGAGG + Intronic
1077219735 11:1410687-1410709 CAGGCGGGGGCTCCTGAGGGTGG - Intronic
1077305911 11:1868631-1868653 CAGGCCTGAGATCCTGAGGGTGG + Intronic
1078338005 11:10478804-10478826 CAGGGCCAGGCTCCAGAGGGAGG - Intronic
1079818590 11:25094719-25094741 GAGGCCCAGGGTGCTGAGGGTGG + Intergenic
1080402124 11:31946074-31946096 CTGGCACTGGTTCCTGAGAGTGG + Intronic
1081744633 11:45464285-45464307 CAGCCACAGGAGCCAGAGAGAGG + Intergenic
1081809817 11:45908487-45908509 TGGGCACAGGATGCTGAGGCAGG - Intergenic
1082846093 11:57726777-57726799 TAGGTATAGCATCCTGAGGGAGG - Intronic
1083224001 11:61273330-61273352 CAGGCACAGAATGATGAGGGCGG + Intronic
1083759153 11:64806381-64806403 GAGGCAGAGGATCCTCAGGGAGG + Intronic
1084650896 11:70488623-70488645 CAGGAATAGGATCCTGAGCCAGG + Intronic
1085101535 11:73804696-73804718 CATGCACAGCATCATGAGAGGGG - Intronic
1085265412 11:75235310-75235332 CAGGCCCAGGATCCTGATCATGG - Intergenic
1085402838 11:76244777-76244799 CAGGGACTGGATCTGGAGGGAGG - Intergenic
1085454908 11:76660243-76660265 CAGGCTCAGGCTGCGGAGGGAGG + Exonic
1085473550 11:76773503-76773525 CAGGCAAAGTGTCCTGAGGGAGG - Intergenic
1085478424 11:76802830-76802852 AAGGCACAGGCTCCAAAGGGAGG + Intergenic
1085525529 11:77161470-77161492 AAGGCACAGAATCCCAAGGGTGG - Intronic
1085870809 11:80347204-80347226 CAGGCACAGGATACGGGGTGGGG + Intergenic
1089398622 11:118152078-118152100 AAGGCAGTGGCTCCTGAGGGAGG + Intronic
1090626060 11:128609947-128609969 CAGGAAGAGCATCCTGAGTGAGG + Intergenic
1090661473 11:128885221-128885243 CAGGCCCAGGTGCCTGAGAGAGG - Intergenic
1090674144 11:128973394-128973416 CAGGAACGGAATCCTGAGGGGGG + Exonic
1091327614 11:134703009-134703031 CAGGCTCAGGCTGCTGAGGAAGG + Intergenic
1092704175 12:11266353-11266375 CTGTCACTGGATACTGAGGGTGG - Intronic
1093473072 12:19525599-19525621 AAGGCACAGGAGGCTGAGGCAGG - Intronic
1096587713 12:52633859-52633881 CAGACACAGTCTCCTGGGGGAGG + Intergenic
1097953125 12:65455092-65455114 CAGGTAAAGAATGCTGAGGGAGG - Intronic
1098339575 12:69438020-69438042 CAGGTACAGGAGGCTGAGGCAGG + Intergenic
1101525345 12:105523422-105523444 CTGGCACAGCATCCTGACAGGGG - Intergenic
1102244201 12:111344715-111344737 CAGGCCCAGGATCCTGGGATGGG + Intronic
1102366643 12:112342343-112342365 CAGGCTCAGGAGGCTGAGGTGGG + Intronic
1104363447 12:128155088-128155110 CAGGCACCAGTGCCTGAGGGAGG - Intergenic
1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG + Intergenic
1106023843 13:25939409-25939431 CAGGCACAGGACCAGGACGGAGG + Intronic
1106305516 13:28505681-28505703 CAGGCACTGCAGCCTGAAGGTGG + Intergenic
1110969760 13:81746746-81746768 AAGACACAGGATCATGGGGGTGG + Intergenic
1112508353 13:99988902-99988924 CAGGCCCAGGCTCCTGAGTGTGG - Intergenic
1113412734 13:110104816-110104838 CAGGCAGAGAAGCCTGAGGTGGG - Intergenic
1113969857 13:114180526-114180548 CAGGCCCAGGAACCAGAGAGCGG - Intergenic
1114500581 14:23165424-23165446 CAGCCTCAGGAACCTGAAGGAGG + Exonic
1117446088 14:55805054-55805076 CATCCACATGATCCTGATGGGGG + Intergenic
1117828488 14:59727315-59727337 CCAGTACAGCATCCTGAGGGAGG - Exonic
1118894668 14:69935838-69935860 TAGGCACAGGATCTGCAGGGAGG - Intronic
1119640406 14:76310362-76310384 CGGGCTCAGGATCCGGAGGGGGG + Intergenic
1121215206 14:92242447-92242469 CCGGCCCTGGATCCTGAGGCTGG + Intergenic
1121579735 14:95019634-95019656 CAAGCACAGGAAACTGAGGAAGG + Intergenic
1122479894 14:102040304-102040326 CAGGCCCTGGATCCTGGGGGTGG - Exonic
1122778066 14:104131553-104131575 CGGGCAAGGCATCCTGAGGGTGG + Intergenic
1122798025 14:104216143-104216165 CAGGCACTGGAGCCTCAGGTCGG + Intergenic
1122903479 14:104791568-104791590 GAGCCACAGGAGCCTGGGGGTGG - Intronic
1123774159 15:23561773-23561795 CAGTCACAGGATTCTTTGGGTGG + Intergenic
1123813866 15:23956398-23956420 CAGTCTCAGGCTCCTGAGGCCGG - Intergenic
1124264243 15:28219393-28219415 CAGGCAAGGGAGGCTGAGGGAGG + Intronic
1124720361 15:32106174-32106196 CAGGGCCAGGGTTCTGAGGGGGG + Intronic
1125541362 15:40471537-40471559 CCGGAACAGGACCCTGCGGGCGG + Exonic
1125577552 15:40765933-40765955 CAGGGAGAGGATACTGAGGGAGG - Exonic
1126176706 15:45742772-45742794 CAGGCAGAGGAGCCTGATGATGG + Intergenic
1128303174 15:66580127-66580149 CAGGCACAAAATACTCAGGGAGG + Intergenic
1129229196 15:74187306-74187328 CAGGCACAGGATCCCAGAGGTGG - Intronic
1129784371 15:78299415-78299437 CAGGCCCTGGGGCCTGAGGGTGG - Intronic
1130387362 15:83423469-83423491 CATGCCCAGGATCCTGGGGAAGG + Intergenic
1132697127 16:1206991-1207013 CATGCCCAGGATGCTGAGGGTGG - Exonic
1132700196 16:1218993-1219015 GAGGCACAGGACTCTGCGGGCGG - Exonic
1132719112 16:1307316-1307338 CAGGGACTGGATTCTGGGGGAGG + Intergenic
1133257629 16:4527037-4527059 CTGCCACAGGAGCCTGAGAGAGG + Intronic
1133273248 16:4621572-4621594 CTGGCACAGGCTCCATAGGGAGG + Intronic
1133317854 16:4895161-4895183 CAGGCACAGGCTCCTGAGAACGG + Intronic
1134089974 16:11386319-11386341 CAGTCCCAGCATCCTGAGGGAGG + Intronic
1136279360 16:29198931-29198953 CATGCCGATGATCCTGAGGGAGG + Intergenic
1137573548 16:49582663-49582685 CAGGCAGTGGAAACTGAGGGAGG + Intronic
1137689342 16:50410646-50410668 CAGCGACAGTAACCTGAGGGAGG + Intergenic
1138207689 16:55136851-55136873 AAGGACCAGGATCCTGTGGGAGG + Intergenic
1138415269 16:56867999-56868021 CAGACACAGGATCCTGGGCTTGG + Intronic
1138526396 16:57610196-57610218 CAAGCACAGGACCCTGGAGGTGG - Intergenic
1139083506 16:63556114-63556136 CAGGCAAGGCATCCTGAAGGAGG + Intergenic
1141725836 16:85787787-85787809 CAGGCACAGGATCCTGAGGGAGG - Intronic
1141791983 16:86243179-86243201 CAGGCAAATGATCCTGGGCGGGG - Intergenic
1142083751 16:88165032-88165054 CATGCCGATGATCCTGAGGGAGG + Intergenic
1142714469 17:1740230-1740252 GAGGCACAGGACAGTGAGGGTGG + Intergenic
1144654333 17:17025612-17025634 CAGGCACAGGATCCCTGGGCTGG + Intergenic
1144671651 17:17136209-17136231 CAGGCCCAGGCTCCTGGAGGAGG - Exonic
1145192839 17:20861157-20861179 CATGGACAGGATGCTGAGGAGGG - Intronic
1145403255 17:22563155-22563177 CATGGACAGGATGCTGAGGAGGG - Intergenic
1145783908 17:27581841-27581863 CAGGCACAGGATCATGGTAGGGG + Intronic
1147354065 17:39877563-39877585 GAAGCACAGGATTTTGAGGGTGG - Intronic
1147511053 17:41069216-41069238 CAGGCACAGGTTGCTGCTGGGGG - Intergenic
1147712406 17:42478568-42478590 CAGTCACAGGATCCTCCAGGGGG - Exonic
1147986238 17:44309078-44309100 CAGGCCCAGAACCCAGAGGGAGG + Intronic
1148142610 17:45339154-45339176 CAGACTCAGGAGCCTGAGGTGGG + Intergenic
1148465969 17:47865515-47865537 CAGGAACAGGTGCCTGAGGGGGG - Intergenic
1148529583 17:48376956-48376978 CAGGCCCAAGATGCAGAGGGAGG + Intronic
1148793551 17:50186734-50186756 CTGGCTCAGGCTCTTGAGGGTGG + Exonic
1150565297 17:66333699-66333721 CAGGCACTGGTTCCTGGGGGAGG - Intronic
1150592881 17:66578714-66578736 CAGGCCCAGGATGCAGAGGTGGG - Intronic
1150739175 17:67765812-67765834 CAGGCACAGGTCTCTGGGGGAGG - Intergenic
1151377071 17:73697194-73697216 GAGCCACAGGAGCCTCAGGGAGG - Intergenic
1151499056 17:74477407-74477429 GAGGCACAGGATGGTAAGGGCGG - Intronic
1152141951 17:78541669-78541691 CAGGGACAGGAGCCTAAGAGGGG - Intronic
1152205040 17:78970101-78970123 CAGGCACAGAGTCCCCAGGGAGG - Intergenic
1152509367 17:80774986-80775008 CAGGCCCAGGAGCCCGAGGGAGG - Intronic
1152624720 17:81383010-81383032 CCTGCACAGGAGGCTGAGGGTGG - Intergenic
1152866397 17:82726338-82726360 CAGTCACAGGAGCCTGAGGGGGG - Intronic
1152939774 17:83162163-83162185 CGATCACAGGCTCCTGAGGGGGG + Intergenic
1154162408 18:11990125-11990147 CGGACACAGGATCCTGAGACTGG - Intronic
1157474478 18:48012522-48012544 AGGGCCCAGGATCCTGAGAGGGG - Intergenic
1157569818 18:48704900-48704922 GAGGCACAGGCCCCTCAGGGTGG + Intronic
1158689884 18:59650781-59650803 CAGGTACAGGATCGGTAGGGAGG - Intronic
1159104095 18:63986002-63986024 AATGCACAGGATGTTGAGGGTGG + Intronic
1159840982 18:73398852-73398874 AAGTCACTGGATCATGAGGGTGG - Intergenic
1160016395 18:75144017-75144039 GAGGCACTGGATCCTGGGAGTGG - Intergenic
1160049812 18:75422169-75422191 CATTCACAGGATGCTGTGGGAGG + Intronic
1160364572 18:78313255-78313277 CAGGCCCAGGCTCCTGGGGACGG + Intergenic
1160705795 19:529685-529707 CGGGCAGAGGGGCCTGAGGGAGG + Intergenic
1161916825 19:7234573-7234595 CAGGGACTGGATCCCCAGGGGGG + Intronic
1162193775 19:8967727-8967749 CAGGGAAAGGATTCAGAGGGAGG - Intronic
1163167440 19:15508020-15508042 TAGGCCCAGGATCCAGAGAGAGG + Intergenic
1166046346 19:40233070-40233092 CAGGCCCAGGGTCCAGCGGGAGG + Exonic
1166799508 19:45447672-45447694 CAGTTAGAGGATCCTGAGTGTGG - Intronic
1167520180 19:49950111-49950133 CAGGCCCTGGAAGCTGAGGGAGG + Exonic
1168342810 19:55635394-55635416 CAGGAAAAGGTTCCTGAAGGAGG + Intronic
925614133 2:5729303-5729325 CAGGCCCAGGAACCATAGGGAGG - Intergenic
925640324 2:5980921-5980943 CAGGCACAGGCTCCTCACGTGGG + Intergenic
926633211 2:15156325-15156347 CAGGCACAGGAGTGTGAGGTTGG + Intergenic
927159104 2:20241730-20241752 CAGGCACAAGGTCATGATGGCGG - Intergenic
927927879 2:27025821-27025843 CAGGCAGGGGAACCTGAGGTGGG + Intronic
928608356 2:32965283-32965305 CAGGGACAGGATTTTGATGGTGG - Intronic
930561015 2:52959908-52959930 CAGGCTCAGGATGCGGTGGGTGG + Intergenic
932471559 2:71962694-71962716 GAGGCAAAAGACCCTGAGGGTGG - Intergenic
934751191 2:96795243-96795265 CAGGCACAGAGGCCTGGGGGCGG + Intronic
935123082 2:100198942-100198964 CAGGCACAGGCCCCTGAGCAGGG - Intergenic
935642255 2:105301848-105301870 CAGCCACAGGAAGCTGAGGCAGG - Intronic
936152020 2:110027257-110027279 CAGGCACAGCCCCCTGAGGTAGG + Intergenic
936192658 2:110344156-110344178 CAGGCACAGCCCCCTGAGGTAGG - Intergenic
936959815 2:118061321-118061343 TAGGGGCAGGAGCCTGAGGGTGG - Intergenic
937482993 2:122282086-122282108 CAGGCACTGGATACTAAGCGGGG + Intergenic
938238404 2:129724277-129724299 CAGCCACAGGTTCCTGTGAGAGG + Intergenic
941713200 2:168736574-168736596 CAGGCACTGGAGGCTGAGGCAGG - Intronic
943849482 2:192699100-192699122 CTGGCCCAGGATCCTGAGAGAGG - Intergenic
944383804 2:199141717-199141739 CAGGCAGAGGATGGAGAGGGCGG + Intergenic
944596560 2:201266545-201266567 CAGGCTCAGGAACTTGAGGGAGG - Exonic
946606446 2:221410598-221410620 CTGACTCAGGATCCTGAAGGAGG + Intergenic
947227324 2:227852939-227852961 CAGGCACAGGATCGGGGGTGGGG + Intergenic
948330027 2:237157268-237157290 CTGGCAGTGGCTCCTGAGGGAGG - Intergenic
948330499 2:237160735-237160757 CAGGCGCAGGTTGCTGAGGCTGG + Intergenic
948487060 2:238288018-238288040 CAGGCCTGGGAACCTGAGGGCGG - Intronic
948513761 2:238489983-238490005 CAGGCCCAGGATTCTGAGCAGGG + Intergenic
949014921 2:241703365-241703387 CTGACACAGGCTCCTAAGGGGGG - Intronic
1169115966 20:3066123-3066145 CTGGCATGGGAACCTGAGGGTGG - Intergenic
1170603556 20:17859667-17859689 CGCGCCCAGGCTCCTGAGGGAGG + Intergenic
1171079160 20:22160497-22160519 CAGCCCCAGGATCCTGCGGGAGG - Intergenic
1171185575 20:23121875-23121897 CAGGCACAGGATGGTGGGGGTGG + Intergenic
1171232595 20:23499645-23499667 CAGGCTCAGGATTCACAGGGGGG + Intergenic
1171324166 20:24276274-24276296 CAGGCACAGGTCTCTGAGTGAGG + Intergenic
1172186046 20:33031646-33031668 CAGGCACAGGATCCGCAGCATGG - Exonic
1172479308 20:35261563-35261585 GGGACACAGGATCCTGAGGGTGG - Intronic
1172960508 20:38795828-38795850 GCGGCACAGGTTGCTGAGGGGGG + Intergenic
1175895055 20:62332468-62332490 CCGGCACAGGGTGCTGTGGGGGG + Exonic
1175995190 20:62809152-62809174 CAGGCACAGTCTCCTGAGATGGG - Intronic
1176097910 20:63352772-63352794 CGGGCAGAGGACCCTGGGGGAGG - Intronic
1176252867 20:64133917-64133939 AATGCAGAGGGTCCTGAGGGTGG - Intergenic
1176262380 20:64188810-64188832 CAGGCACCGGAGCCTGCGGTGGG + Intronic
1179092839 21:38283888-38283910 CAGGCAAAGGAGACTGAGGAGGG - Intronic
1180199487 21:46215877-46215899 CTGGCCCAGGGCCCTGAGGGCGG - Intronic
1180706150 22:17811091-17811113 CAGGGACAGGAGGCTGAGTGGGG + Intronic
1181495148 22:23283484-23283506 CAGGCACAGGCCCCTGTGGTGGG - Intronic
1181633434 22:24163379-24163401 CAGGGACAGGGCCCTGAGAGGGG + Intronic
1182786602 22:32913042-32913064 CTGGTACAGGATAGTGAGGGAGG + Intronic
1183526128 22:38323967-38323989 CAGGGGCAGGAGCCTGATGGGGG - Intronic
1183598553 22:38826735-38826757 TAGGCTGAGGACCCTGAGGGTGG + Exonic
1183672392 22:39280550-39280572 CAGGCACAGGCTCCATGGGGCGG - Intergenic
1183987005 22:41575512-41575534 CAGGAAGAGGGGCCTGAGGGCGG + Exonic
1184149401 22:42629600-42629622 CAGGCACTGGATCTGAAGGGTGG - Intronic
1184466886 22:44673750-44673772 CAGGGAGAAGATCCTGAGCGTGG + Intronic
1184604412 22:45563948-45563970 CAGGGCCAGGATCCTCAGTGGGG - Intronic
1184757786 22:46526636-46526658 CAGGCCCTGGAGGCTGAGGGAGG - Intronic
1184853937 22:47136340-47136362 CAGCCCCAGGATCTTGAGGTTGG - Intronic
1185109216 22:48891564-48891586 CTGGCACAGGTTCCTCTGGGTGG - Intergenic
1185169211 22:49282711-49282733 CAGGCACAGGGACCTGGGTGGGG - Intergenic
950372156 3:12540206-12540228 CAGGCACAACCCCCTGAGGGCGG - Exonic
950727602 3:14927210-14927232 CAGGCAAAGGCCCCTCAGGGTGG - Intronic
952652106 3:35739022-35739044 AAGGCACAGGCTCCTCAGGGTGG - Intronic
953033396 3:39192072-39192094 CAGGCCCAGGATCTGGAGGAAGG - Intronic
953360119 3:42288542-42288564 CAGGCACAGGATGCCAAGGAAGG + Intergenic
953689978 3:45109716-45109738 CAGGTACATGACCCTGAGAGTGG + Intronic
953784248 3:45898531-45898553 CAGGAGCAGGATCCTGGAGGCGG - Intronic
954631853 3:52052036-52052058 CAGACAGAGGAGTCTGAGGGTGG - Intronic
955675995 3:61449503-61449525 TAGGCACAGGAGCCTGGGTGGGG + Intergenic
957492269 3:80943812-80943834 CATGCAAAGGATCCAGGGGGTGG + Intergenic
960619932 3:119627789-119627811 CAGCCAGCAGATCCTGAGGGTGG - Intronic
961624845 3:128254758-128254780 CAGTCACAGAGTCCTGAGAGTGG + Intronic
961646702 3:128396582-128396604 CTGGGACTGGTTCCTGAGGGTGG + Intronic
962581837 3:136804997-136805019 TAGGCACAGGCTCCTAAGGGGGG - Intergenic
963046745 3:141108158-141108180 CAGGCAGAGGCTCCTGAGCTCGG - Intronic
966684671 3:182681021-182681043 CAAGCACAGGATCTTGAGCCTGG - Intergenic
968451641 4:678795-678817 CCAGCACAGGCTCCTGGGGGTGG - Intronic
968804092 4:2761595-2761617 CAGGCACAAAGTCCTGAGGCAGG - Intergenic
968811495 4:2801470-2801492 CAGGCCCAGGAGCAAGAGGGAGG - Intronic
969057925 4:4413698-4413720 CAGGCACAGGCCCCTGGAGGAGG + Intronic
969304057 4:6315174-6315196 AAGGCACAAAATCCTGGGGGAGG - Intergenic
970158018 4:13160900-13160922 GAGGCACAGAATCCTGAATGGGG + Intergenic
970599234 4:17627715-17627737 CAGGCACAGGAGGCTGAGGCAGG + Exonic
972270080 4:37502502-37502524 CAGGCACAGGGTGCTGGTGGGGG + Intronic
974428966 4:61771842-61771864 GTGGCACTGGATCATGAGGGTGG - Intronic
978284685 4:107061998-107062020 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
978825562 4:113018667-113018689 GAGGCACAGGAACCTGAGCATGG + Intronic
983172564 4:164552302-164552324 TAGGCACAGGATGCGGGGGGTGG + Intergenic
985577310 5:679363-679385 CAGGGGCAGGATCCTGGTGGGGG + Intronic
985592224 5:771414-771436 CAGGGGCAGGATCCTGGTGGGGG + Intergenic
985770540 5:1807508-1807530 CAGCCACAGAAGCCTCAGGGAGG - Intronic
985885535 5:2674898-2674920 CAGGCACAGGACACTCAGGTGGG - Intergenic
986060563 5:4186344-4186366 CAGGTACAGAGTCCTGGGGGAGG + Intergenic
987968043 5:24902408-24902430 CAGGCAAAGGATCACGTGGGAGG + Intergenic
990184584 5:53199911-53199933 TAGGCATAGCATCCTGAGGAGGG + Intergenic
990381005 5:55222117-55222139 CAGGGACAGGATATAGAGGGTGG - Intronic
990575273 5:57117785-57117807 CAGCCACAGCCTCCTGAGGAAGG - Intergenic
991292779 5:65048831-65048853 GAAGCACAGGATCGTGAGAGAGG - Intergenic
994039116 5:95237530-95237552 CTAGCAAAGGTTCCTGAGGGAGG - Intronic
996389230 5:122941936-122941958 CAGGCACAGGCTCCTGTGACAGG + Intronic
997475824 5:134141875-134141897 CAGCCACAGGCTCCTGAGGCTGG + Intronic
997591353 5:135074627-135074649 GAGCCACAGGATCCTGAGGTTGG - Intronic
998558801 5:143151842-143151864 CAGGCTCAGGAGGCTGAGGCAGG + Intronic
999125501 5:149243018-149243040 CAGTCACAGTCTCCTGAGAGTGG + Intronic
999243546 5:150140943-150140965 GAGCCTCAGGACCCTGAGGGAGG - Intronic
1000160933 5:158597250-158597272 CAGGCACAGGGTACTGGGGCTGG - Intergenic
1000870661 5:166573232-166573254 CAGGCACAGAATGCTGAGTGTGG + Intergenic
1001051572 5:168418458-168418480 CAGGCAGAGGATCCAGAAGGTGG - Intronic
1001179428 5:169505419-169505441 AAGGCACAGGATAATGATGGTGG - Intergenic
1002184776 5:177449203-177449225 CAGACACAGGACCCTTAGGTTGG - Intronic
1002351921 5:178589675-178589697 CTGGCACGGGACCCTGAGGCCGG + Intronic
1003080283 6:3016015-3016037 CAGGCACATGATGCTCAAGGGGG - Intronic
1003126336 6:3358918-3358940 CGGGCACAGCATCCTGGGTGGGG + Intronic
1004472615 6:15942635-15942657 CAGGCGCAAGAGCATGAGGGAGG + Intergenic
1004673293 6:17817293-17817315 CAGGCACTGCAGCCTGTGGGAGG + Intronic
1005298479 6:24449010-24449032 CAAGCACAGGATGCTAAGTGGGG + Intronic
1005799399 6:29405161-29405183 GAGGAACAGGACACTGAGGGTGG + Intronic
1005822180 6:29607195-29607217 CAGGCCCAGGAGCCAGAGGCGGG + Exonic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006367823 6:33625848-33625870 CAGGCTCAGGATCCCTAGGTCGG + Intronic
1006833189 6:36981319-36981341 CAGACACAGGTGCCTGAGAGAGG - Intronic
1007041934 6:38730345-38730367 CAGGCACAAGATGCTGAGATAGG - Intronic
1014247303 6:119082007-119082029 TAGGCACAGGATGGTGGGGGTGG + Intronic
1014551730 6:122796830-122796852 CAGGTACAGGAACATGAGGTGGG - Exonic
1018616783 6:165694313-165694335 CAGGCACGGGACCATGAGAGAGG + Intronic
1019441139 7:1047709-1047731 CAGGCACTGCATCCTCAGGATGG - Intronic
1022563021 7:31369480-31369502 CAGGCACAGGATGCCGGGTGGGG + Intergenic
1023187462 7:37547254-37547276 CAGGCTCAGGATCCTCTGAGAGG - Intergenic
1023929034 7:44693760-44693782 CCGGCACAGGGACCAGAGGGCGG - Intronic
1024005146 7:45219845-45219867 CAGGCACAGGAGGCAGATGGGGG - Intergenic
1024253141 7:47521270-47521292 CAGGAACAGGATCCCGTGTGAGG - Intronic
1024512721 7:50216084-50216106 CAGGCACAGGGTCCTAGAGGAGG - Intergenic
1024959210 7:54957275-54957297 CAGGCAGAGGGTCCCCAGGGAGG - Intergenic
1026413492 7:70153418-70153440 CAGGCACAGAATTGGGAGGGAGG + Intronic
1026903213 7:74048328-74048350 CTGGAGCAGGATCCTGGGGGAGG + Intronic
1029222781 7:99003534-99003556 GAGACACAGGAGCCTGAGGGCGG - Intronic
1032074007 7:128827706-128827728 CAGGCTCAGGTTTCTGAGGACGG + Intergenic
1032082813 7:128868622-128868644 CAAGCATGGGTTCCTGAGGGAGG - Intronic
1033627948 7:143129273-143129295 CAGGTACAGGATCTTGGAGGAGG - Intergenic
1034072282 7:148198101-148198123 CAGGCTGAGAAGCCTGAGGGTGG + Intronic
1034349821 7:150408400-150408422 CAGCCAGAGGGTCCCGAGGGAGG - Intronic
1034537234 7:151733056-151733078 CAGGCACAGGCTTGGGAGGGAGG + Intronic
1034553917 7:151837976-151837998 CACGCACAGGACCCTGGAGGAGG + Intronic
1035850098 8:2910474-2910496 CACACACAGGATGCTGTGGGAGG + Intergenic
1036778281 8:11628497-11628519 CAGGGACAGCTTCCTGGGGGAGG + Intergenic
1036907795 8:12721417-12721439 CTGTCACAGGATCCTTGGGGTGG - Intergenic
1036991840 8:13607092-13607114 CACACACAGGATCCTGTCGGTGG - Intergenic
1037110972 8:15164277-15164299 CAACCTCAGAATCCTGAGGGTGG + Intronic
1038861513 8:31393426-31393448 CAGGTACAAGACCCTGAGGTAGG + Intergenic
1039311362 8:36321392-36321414 CAGGCACAGGAGCCGCAGGGGGG + Intergenic
1041248022 8:55907395-55907417 CAGGAACAGGGTCATGAGAGGGG + Intronic
1043544056 8:81295408-81295430 CAGGCTCAGGAACCAGAGGCAGG + Intergenic
1044071491 8:87766124-87766146 TAGGCACAGCATACTGTGGGAGG - Intergenic
1045651432 8:104345077-104345099 CAGGCACTGGAGGCTGAGCGTGG - Intronic
1046218236 8:111178195-111178217 CGGGCACAGGAGCCTGAGGTGGG - Intergenic
1049368809 8:142253746-142253768 CAGCCGCAGGGTCCTGCGGGAGG - Intronic
1051692361 9:19728954-19728976 GAAGCACAGGAGCCTGAGGTAGG + Intronic
1053174219 9:35910554-35910576 AGGGCCCAGGATCCTCAGGGGGG + Intergenic
1053222794 9:36325921-36325943 CAGGCCCAGGGTCCTGAAGAAGG + Intergenic
1053268061 9:36730359-36730381 CAGGCACAGGGTTCTGGGGCTGG + Intergenic
1053886220 9:42646491-42646513 GAGGCTCAGGGTCCTGTGGGTGG + Intergenic
1054225240 9:62453940-62453962 GAGGCTCAGGGTCCTGTGGGTGG + Intergenic
1055560902 9:77520675-77520697 CAAGCACAGGAGTCTGAGGCAGG - Intronic
1056830795 9:89915715-89915737 CACACACAGGTTCCTGGGGGTGG - Intergenic
1057180780 9:93028918-93028940 CAGGCACAGGAGACAGAGGAGGG + Intronic
1057230995 9:93321098-93321120 CAGGCACAGGAGCCTTATGCTGG + Intronic
1058985755 9:110207454-110207476 CAGGAACTGGATGCTGAGTGGGG + Exonic
1059000274 9:110341505-110341527 CAGGAAGAGAATCCTGAGAGTGG + Intergenic
1059605110 9:115825621-115825643 AAGTCACTGGATCATGAGGGTGG + Intergenic
1059976820 9:119726400-119726422 TAGGTACAGGATCCGTAGGGCGG - Intergenic
1060482967 9:124028680-124028702 CTGCCACATGGTCCTGAGGGAGG - Intronic
1061052701 9:128205577-128205599 CAGGCACAGGGACGTGTGGGTGG + Intronic
1061202587 9:129146247-129146269 CAGGCCCAGGATCCTGGCTGTGG + Intronic
1061403750 9:130382627-130382649 CTGGCACAGGTCCCTGGGGGCGG - Intronic
1062192170 9:135253633-135253655 CAGGAAGAGGAGCATGAGGGCGG - Intergenic
1062261471 9:135665186-135665208 GTGTCACAGGACCCTGAGGGTGG + Intronic
1062526671 9:136980608-136980630 CAGGCACAGCCTCCTAGGGGTGG + Intronic
1062536241 9:137022260-137022282 CAGGCTGAGCATCCTGAGGATGG + Intronic
1062565101 9:137160833-137160855 CAGGCAGACGATGCTGACGGTGG + Intronic
1186363256 X:8864478-8864500 TAAGGACAGGAACCTGAGGGAGG + Intergenic
1186843219 X:13505910-13505932 CAAGAACAGGATTTTGAGGGGGG + Intergenic
1187274299 X:17804946-17804968 GAGGAACAGGGGCCTGAGGGAGG - Intronic
1187891717 X:23942375-23942397 CAGCCACAGGAACGAGAGGGAGG - Intergenic
1190933014 X:54966377-54966399 CAGGCTCAGGATACTGAATGGGG - Intronic
1192582987 X:72300079-72300101 CAGGCACAGGTGCATGAGAGGGG - Intronic
1196458521 X:115906522-115906544 CAGGGACAGGATCTTGAGGGAGG - Intergenic
1197717802 X:129722039-129722061 CAGCCCCAGCATCCTGAAGGGGG + Intergenic
1198478476 X:137018386-137018408 CAACCACAGGATCCTGAATGAGG - Intergenic
1199607100 X:149586110-149586132 CAGGGCCAGGACCCTGAGGGAGG - Intronic
1199607399 X:149587101-149587123 CAAGGCCAGGACCCTGAGGGAGG - Intronic
1199631724 X:149782266-149782288 CAAGGCCAGGACCCTGAGGGAGG + Intronic
1199632022 X:149783258-149783280 CAGGGCCAGGACCCTGAGGGAGG + Intronic
1199634885 X:149805461-149805483 CAAGGTCAGGATTCTGAGGGAGG + Intergenic
1199642965 X:149881514-149881536 CAAGGGCAGGACCCTGAGGGAGG + Intronic
1201182690 Y:11364770-11364792 CAGGCACTGGGTCCTGTTGGGGG + Intergenic