ID: 1141728111

View in Genome Browser
Species Human (GRCh38)
Location 16:85803826-85803848
Sequence CTGCATTTGGGCTCCTAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141728104_1141728111 11 Left 1141728104 16:85803792-85803814 CCCGTGCTCTGTGACTCCTGAGT 0: 1
1: 0
2: 3
3: 32
4: 264
Right 1141728111 16:85803826-85803848 CTGCATTTGGGCTCCTAGGTCGG 0: 1
1: 0
2: 1
3: 6
4: 102
1141728105_1141728111 10 Left 1141728105 16:85803793-85803815 CCGTGCTCTGTGACTCCTGAGTG 0: 1
1: 0
2: 3
3: 24
4: 316
Right 1141728111 16:85803826-85803848 CTGCATTTGGGCTCCTAGGTCGG 0: 1
1: 0
2: 1
3: 6
4: 102
1141728106_1141728111 -5 Left 1141728106 16:85803808-85803830 CCTGAGTGCACGCTTCCTCTGCA 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1141728111 16:85803826-85803848 CTGCATTTGGGCTCCTAGGTCGG 0: 1
1: 0
2: 1
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141728111 Original CRISPR CTGCATTTGGGCTCCTAGGT CGG Intronic
900635736 1:3664178-3664200 CTGCATCTGGGCTGGTAGGAAGG - Intronic
911151007 1:94596739-94596761 CAGCCTGTGGGATCCTAGGTGGG + Intergenic
915735820 1:158084309-158084331 CTGCATGTGCGCCTCTAGGTAGG - Intronic
918105264 1:181411102-181411124 CTGGTTTTGGGCTCCTGGCTAGG + Intergenic
918984178 1:191601903-191601925 CTGCAGGTGGGCTCTTAGCTTGG - Intergenic
919927550 1:202200133-202200155 CTGCTCTTGGGCTCCTGGGCCGG + Intronic
923771588 1:236942289-236942311 CTCCTTTTGGCCTCCTTGGTTGG - Intergenic
1067186114 10:44029545-44029567 CTGCACTGGGGGTCCTGGGTGGG + Intergenic
1067190526 10:44064239-44064261 CTGCATTTGGGTTCTTCTGTAGG - Intergenic
1069974410 10:72200884-72200906 CTGCATGTGGGCTCCCATATTGG - Intronic
1073060586 10:100731165-100731187 CTGCATGCGGGCTCCTCGGGTGG - Intergenic
1073584261 10:104693517-104693539 CTGCATTTTGGCTCTTGGGTGGG + Intronic
1076179136 10:128392397-128392419 GTACATTTGGGCTCCTGGTTTGG - Intergenic
1077221764 11:1421084-1421106 CTGCCTGTGGGCTCCTGGCTTGG + Intronic
1078871526 11:15349514-15349536 CTGCAACTGGGCTCCTAGTCAGG - Intergenic
1084834106 11:71790506-71790528 CTTCACTGGGGCTCCTAGGATGG - Intronic
1085729910 11:78988589-78988611 CTGCATCTGAGCTCTGAGGTGGG - Intronic
1086029607 11:82338199-82338221 CTGCCTGTGTGTTCCTAGGTAGG - Intergenic
1090554468 11:127859282-127859304 GTGCAGTGGGGCTCCCAGGTAGG + Intergenic
1091439557 12:502020-502042 CTTCATTCCGTCTCCTAGGTGGG + Intronic
1093236567 12:16615724-16615746 CTTCCTTTGGGCTTCCAGGTTGG - Intergenic
1098547918 12:71731700-71731722 CAACATTTGGGCTCCAAGGCAGG - Intergenic
1100035450 12:90245587-90245609 CTACATCTGGGCTCCAAGGCGGG + Intergenic
1100223219 12:92529687-92529709 CTGGATGTGGGCTGCTGGGTTGG + Intergenic
1102742602 12:115221599-115221621 CTGCATTTGAGAGCCTAAGTGGG - Intergenic
1106579525 13:31005319-31005341 CTGCGCTTGGGCTCCTAGCCAGG - Intergenic
1109275453 13:60298888-60298910 CTGGATGTGGGCTCCTGGATAGG - Intergenic
1112019466 13:95359243-95359265 CAGCATTTGGACACCAAGGTGGG - Intergenic
1113318993 13:109213818-109213840 CTGCATGTGAGCTGCTTGGTGGG - Intergenic
1114597655 14:23926954-23926976 CTCCATCTGGACTCCTAGGCAGG + Intergenic
1115463329 14:33686157-33686179 CTACCTTTTGGCTCTTAGGTTGG - Intronic
1115576173 14:34714430-34714452 CTGATTTTGGCCTCCAAGGTGGG - Intronic
1121049694 14:90812356-90812378 CTTCATGTGGGCTCACAGGTCGG - Intronic
1121944677 14:98108086-98108108 CTCCATTTTGGCTCCAAAGTGGG - Intergenic
1122186596 14:100003028-100003050 CAGCATACGGGCTCCTATGTCGG - Intronic
1122427558 14:101620642-101620664 CTGGAGTTGGGGTCCCAGGTGGG + Intergenic
1127147127 15:56035832-56035854 CTGCCTGTGTGCTCCTAGCTAGG - Intergenic
1138910809 16:61396559-61396581 CTACACTTTGGCTTCTAGGTAGG + Intergenic
1140016389 16:71190827-71190849 CTGCAATTGGGCTGGTAGGTCGG - Intronic
1140192328 16:72828648-72828670 CTGCATTTGGGGGCCTGGGCAGG - Intronic
1141728111 16:85803826-85803848 CTGCATTTGGGCTCCTAGGTCGG + Intronic
1142174153 16:88637250-88637272 CTGCCTTTGGCCTCCTTGATCGG - Intergenic
1144058835 17:11563314-11563336 CTCCATCTGGGCTGCTAGGAAGG + Exonic
1145810347 17:27760553-27760575 CTGCAGTTCTGCTCCTAGGCAGG + Intronic
1146005194 17:29156344-29156366 CTTCATGTGGGCTCCTGTGTGGG + Intronic
1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG + Intronic
1152588172 17:81198353-81198375 CTGCGGTTGGCCTCCTATGTGGG - Intronic
1152717139 17:81905577-81905599 CTGGCTGTGGGCTCCTAGGCGGG - Intronic
1153992343 18:10411634-10411656 CTGCAGTTTGCCTTCTAGGTGGG - Intergenic
1160313601 18:77820655-77820677 CTGCACCTGGCCTCCCAGGTTGG + Intergenic
1162115846 19:8428973-8428995 CTACACTCTGGCTCCTAGGTGGG - Intronic
1166374727 19:42321180-42321202 AAGCTTTTGGGCTCCTGGGTCGG + Intronic
1166794746 19:45419696-45419718 CTGCAGAGGGGCCCCTAGGTTGG + Intronic
925260981 2:2528468-2528490 CTGCATTAATGCTCCTAGGATGG - Intergenic
929861807 2:45684654-45684676 CTGCATCTGGGCGCCTAGTCAGG + Intronic
931712049 2:64996678-64996700 CTGCATTTGTGCTGCCATGTTGG - Intronic
932460574 2:71879489-71879511 CAGCCTTTGGGCTCCTGGGCAGG + Intergenic
935444354 2:103140352-103140374 CAGCATCTGGGCTCAGAGGTGGG + Intergenic
936293426 2:111246800-111246822 CTGCATTAGGGCCCCCAGGGAGG - Intergenic
941809641 2:169742757-169742779 GTCCATTTGGGCTACTAGGAGGG - Intronic
947830662 2:233139336-233139358 CTGCATTTGGGCTGCTAGGAGGG + Intronic
1170071417 20:12373290-12373312 CTGCATTTGGGCTGCTCTGGAGG - Intergenic
1178803341 21:35817620-35817642 CTTCCTGTGGGCTCCTGGGTGGG - Intronic
1179055935 21:37934107-37934129 CAGCATTTGGGCACCTATGAGGG - Intergenic
1182520090 22:30880305-30880327 CTGGCTCTGGGCTCCCAGGTGGG - Intronic
1183439182 22:37813578-37813600 CTGCAGCTTGGCTTCTAGGTCGG - Exonic
959051693 3:101530531-101530553 ATGCAGTTGGGCTCTTAGCTTGG + Intergenic
961300579 3:125919588-125919610 CTTCACTGGGGCTCCTAGGATGG - Intergenic
961397017 3:126600992-126601014 CTGAATATGGAATCCTAGGTTGG + Intronic
961887921 3:130108499-130108521 CTTCACTGGGGCTCCTAGGATGG + Intronic
963967045 3:151383761-151383783 CTGTATTTTGTCTGCTAGGTAGG + Exonic
966974660 3:185073414-185073436 CTGCTGTTGAGCTGCTAGGTGGG + Intergenic
968727116 4:2252831-2252853 CTGCATGTGGACTCCAGGGTGGG - Intronic
969816910 4:9693823-9693845 CTTCACTGGGGCTCCTAGGATGG - Intergenic
971068297 4:23060140-23060162 CTGCCTTTGGGATGCTGGGTAGG - Intergenic
977731589 4:100359937-100359959 TTGCATTTCAGCTCCTGGGTGGG - Intergenic
978279282 4:106990456-106990478 CTGTACTTGGTCTTCTAGGTTGG - Intronic
981699541 4:147594033-147594055 CTGAATTAGGGCTGCCAGGTAGG + Intergenic
984190978 4:176605295-176605317 CTTCAATTGGGTTCCAAGGTTGG + Intergenic
993589461 5:89777233-89777255 CTGGATTTAGACTTCTAGGTTGG - Intergenic
997768318 5:136527106-136527128 CTGTATTTAGGCTTCTGGGTTGG + Intergenic
999366963 5:151029520-151029542 CTGCTTTTTGGCTCCTACCTTGG + Intergenic
1001419086 5:171573517-171573539 CTGCATTTGGGATCCTATGGTGG - Intergenic
1001472157 5:172022069-172022091 CTGCTTTTGGGGACCGAGGTGGG + Intergenic
1007307523 6:40918599-40918621 CAACATTTGGGCGCCAAGGTAGG - Intergenic
1015394254 6:132717326-132717348 CTGCATTTGGGGACCTTGGCTGG - Intergenic
1018459234 6:163981628-163981650 CTGCATGTGGGCTCCTGGGCAGG + Intergenic
1022505917 7:30908544-30908566 CTGCATTTGGGCTCTGGGATGGG + Intergenic
1032460801 7:132108889-132108911 TGGCATTTCGGCTCCTAGGTAGG + Intergenic
1033313861 7:140282101-140282123 CTGCTCCTGGGCTCCTGGGTTGG + Intergenic
1035317281 7:158004050-158004072 CTGCTTTTCGGCTCCTCGTTTGG + Intronic
1039790066 8:40868538-40868560 CTGCACTTGGGCACCAAGGAGGG + Intronic
1041332196 8:56739044-56739066 CTGCATTTTGGCTCTGAAGTAGG + Intergenic
1043476266 8:80608805-80608827 CTGCATTGGGGCTTATAGGAAGG + Intergenic
1045896697 8:107226923-107226945 ATGCATATTGACTCCTAGGTGGG + Intergenic
1049326757 8:142025548-142025570 CTGCCTTTGGCCTCCTCGTTGGG - Intergenic
1055056334 9:72027702-72027724 CTGCATATTGGCTCCTCTGTTGG - Intergenic
1055482717 9:76725687-76725709 CTGCATGTGTGCTCCAAGATTGG - Intronic
1060224327 9:121782123-121782145 CTGCATTTGGGCTGATAAGCAGG + Intronic
1062164225 9:135098620-135098642 CTGGATTAGGGCTCCTGGGCAGG + Intronic
1186308957 X:8296646-8296668 CAGCATCTGGGCTCACAGGTAGG - Intergenic
1197095785 X:122593321-122593343 TTGCATATGGAATCCTAGGTGGG - Intergenic
1199150762 X:144483498-144483520 CTCCATTTGTCTTCCTAGGTAGG + Intergenic
1200012434 X:153128824-153128846 GTGCCTTTGGGCTCCTTGGGCGG + Intergenic
1200027165 X:153271095-153271117 GTGCCTTTGGGCTCCTTGGGCGG - Intergenic
1200764255 Y:7067084-7067106 ATGGTTTTGGGCTCCTGGGTAGG - Intronic
1202174021 Y:22080918-22080940 GGGCATTTGGGCTCCTGGTTTGG - Intronic
1202217339 Y:22505464-22505486 GGGCATTTGGGCTCCTGGTTTGG + Intronic
1202325847 Y:23690595-23690617 GGGCATTTGGGCTCCTGGTTTGG - Intergenic
1202544924 Y:25979459-25979481 GGGCATTTGGGCTCCTGGTTTGG + Intergenic