ID: 1141730966

View in Genome Browser
Species Human (GRCh38)
Location 16:85822599-85822621
Sequence CTGGAAATACCCGGTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141730956_1141730966 22 Left 1141730956 16:85822554-85822576 CCAAGTCATCCAGCAGCTGTTCA No data
Right 1141730966 16:85822599-85822621 CTGGAAATACCCGGTTTTAAAGG No data
1141730963_1141730966 -5 Left 1141730963 16:85822581-85822603 CCTTATGTGGCCGCTATGCTGGA No data
Right 1141730966 16:85822599-85822621 CTGGAAATACCCGGTTTTAAAGG No data
1141730959_1141730966 -2 Left 1141730959 16:85822578-85822600 CCCCCTTATGTGGCCGCTATGCT No data
Right 1141730966 16:85822599-85822621 CTGGAAATACCCGGTTTTAAAGG No data
1141730961_1141730966 -4 Left 1141730961 16:85822580-85822602 CCCTTATGTGGCCGCTATGCTGG No data
Right 1141730966 16:85822599-85822621 CTGGAAATACCCGGTTTTAAAGG No data
1141730960_1141730966 -3 Left 1141730960 16:85822579-85822601 CCCCTTATGTGGCCGCTATGCTG No data
Right 1141730966 16:85822599-85822621 CTGGAAATACCCGGTTTTAAAGG No data
1141730957_1141730966 13 Left 1141730957 16:85822563-85822585 CCAGCAGCTGTTCAGCCCCCTTA No data
Right 1141730966 16:85822599-85822621 CTGGAAATACCCGGTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141730966 Original CRISPR CTGGAAATACCCGGTTTTAA AGG Intergenic
No off target data available for this crispr