ID: 1141736179

View in Genome Browser
Species Human (GRCh38)
Location 16:85855372-85855394
Sequence TGTCACAGGCTACCCCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141736174_1141736179 2 Left 1141736174 16:85855347-85855369 CCACTCCATTCTATTGGTCAAAG No data
Right 1141736179 16:85855372-85855394 TGTCACAGGCTACCCCAGAGGGG No data
1141736172_1141736179 24 Left 1141736172 16:85855325-85855347 CCTTGGAAGTTGCAGGTCATTTC No data
Right 1141736179 16:85855372-85855394 TGTCACAGGCTACCCCAGAGGGG No data
1141736175_1141736179 -3 Left 1141736175 16:85855352-85855374 CCATTCTATTGGTCAAAGCATGT No data
Right 1141736179 16:85855372-85855394 TGTCACAGGCTACCCCAGAGGGG No data
1141736171_1141736179 28 Left 1141736171 16:85855321-85855343 CCAGCCTTGGAAGTTGCAGGTCA No data
Right 1141736179 16:85855372-85855394 TGTCACAGGCTACCCCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141736179 Original CRISPR TGTCACAGGCTACCCCAGAG GGG Intergenic
No off target data available for this crispr