ID: 1141739057

View in Genome Browser
Species Human (GRCh38)
Location 16:85878176-85878198
Sequence GAAAGCACACACTTTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141739055_1141739057 11 Left 1141739055 16:85878142-85878164 CCTAGAACTTAAAGAATAAAAAA No data
Right 1141739057 16:85878176-85878198 GAAAGCACACACTTTCAGCTGGG No data
1141739054_1141739057 12 Left 1141739054 16:85878141-85878163 CCCTAGAACTTAAAGAATAAAAA No data
Right 1141739057 16:85878176-85878198 GAAAGCACACACTTTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141739057 Original CRISPR GAAAGCACACACTTTCAGCT GGG Intergenic
No off target data available for this crispr