ID: 1141739922

View in Genome Browser
Species Human (GRCh38)
Location 16:85884325-85884347
Sequence GGATGCAGATGTGCAGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141739922_1141739928 8 Left 1141739922 16:85884325-85884347 CCAGTTGCTGCACATCTGCATCC No data
Right 1141739928 16:85884356-85884378 AGGCTAGCCTGCTGCCCACGAGG No data
1141739922_1141739929 14 Left 1141739922 16:85884325-85884347 CCAGTTGCTGCACATCTGCATCC No data
Right 1141739929 16:85884362-85884384 GCCTGCTGCCCACGAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141739922 Original CRISPR GGATGCAGATGTGCAGCAAC TGG (reversed) Intergenic
No off target data available for this crispr