ID: 1141740260

View in Genome Browser
Species Human (GRCh38)
Location 16:85887046-85887068
Sequence TGGTCATGGTTTGGTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141740260_1141740275 23 Left 1141740260 16:85887046-85887068 CCCCTCCCACCAAACCATGACCA No data
Right 1141740275 16:85887092-85887114 GACAATGGACTGCCCCCTACGGG No data
1141740260_1141740269 -7 Left 1141740260 16:85887046-85887068 CCCCTCCCACCAAACCATGACCA No data
Right 1141740269 16:85887062-85887084 ATGACCAACTTGTGGTCTCTGGG No data
1141740260_1141740272 1 Left 1141740260 16:85887046-85887068 CCCCTCCCACCAAACCATGACCA No data
Right 1141740272 16:85887070-85887092 CTTGTGGTCTCTGGGGACGCTGG No data
1141740260_1141740268 -8 Left 1141740260 16:85887046-85887068 CCCCTCCCACCAAACCATGACCA No data
Right 1141740268 16:85887061-85887083 CATGACCAACTTGTGGTCTCTGG No data
1141740260_1141740273 8 Left 1141740260 16:85887046-85887068 CCCCTCCCACCAAACCATGACCA No data
Right 1141740273 16:85887077-85887099 TCTCTGGGGACGCTGGACAATGG No data
1141740260_1141740270 -6 Left 1141740260 16:85887046-85887068 CCCCTCCCACCAAACCATGACCA No data
Right 1141740270 16:85887063-85887085 TGACCAACTTGTGGTCTCTGGGG No data
1141740260_1141740276 24 Left 1141740260 16:85887046-85887068 CCCCTCCCACCAAACCATGACCA No data
Right 1141740276 16:85887093-85887115 ACAATGGACTGCCCCCTACGGGG No data
1141740260_1141740274 22 Left 1141740260 16:85887046-85887068 CCCCTCCCACCAAACCATGACCA No data
Right 1141740274 16:85887091-85887113 GGACAATGGACTGCCCCCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141740260 Original CRISPR TGGTCATGGTTTGGTGGGAG GGG (reversed) Intergenic
No off target data available for this crispr