ID: 1141740261

View in Genome Browser
Species Human (GRCh38)
Location 16:85887047-85887069
Sequence TTGGTCATGGTTTGGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141740261_1141740269 -8 Left 1141740261 16:85887047-85887069 CCCTCCCACCAAACCATGACCAA No data
Right 1141740269 16:85887062-85887084 ATGACCAACTTGTGGTCTCTGGG No data
1141740261_1141740268 -9 Left 1141740261 16:85887047-85887069 CCCTCCCACCAAACCATGACCAA No data
Right 1141740268 16:85887061-85887083 CATGACCAACTTGTGGTCTCTGG No data
1141740261_1141740272 0 Left 1141740261 16:85887047-85887069 CCCTCCCACCAAACCATGACCAA No data
Right 1141740272 16:85887070-85887092 CTTGTGGTCTCTGGGGACGCTGG No data
1141740261_1141740270 -7 Left 1141740261 16:85887047-85887069 CCCTCCCACCAAACCATGACCAA No data
Right 1141740270 16:85887063-85887085 TGACCAACTTGTGGTCTCTGGGG No data
1141740261_1141740274 21 Left 1141740261 16:85887047-85887069 CCCTCCCACCAAACCATGACCAA No data
Right 1141740274 16:85887091-85887113 GGACAATGGACTGCCCCCTACGG No data
1141740261_1141740275 22 Left 1141740261 16:85887047-85887069 CCCTCCCACCAAACCATGACCAA No data
Right 1141740275 16:85887092-85887114 GACAATGGACTGCCCCCTACGGG No data
1141740261_1141740273 7 Left 1141740261 16:85887047-85887069 CCCTCCCACCAAACCATGACCAA No data
Right 1141740273 16:85887077-85887099 TCTCTGGGGACGCTGGACAATGG No data
1141740261_1141740276 23 Left 1141740261 16:85887047-85887069 CCCTCCCACCAAACCATGACCAA No data
Right 1141740276 16:85887093-85887115 ACAATGGACTGCCCCCTACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141740261 Original CRISPR TTGGTCATGGTTTGGTGGGA GGG (reversed) Intergenic
No off target data available for this crispr