ID: 1141740263

View in Genome Browser
Species Human (GRCh38)
Location 16:85887051-85887073
Sequence CAAGTTGGTCATGGTTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141740263_1141740274 17 Left 1141740263 16:85887051-85887073 CCCACCAAACCATGACCAACTTG No data
Right 1141740274 16:85887091-85887113 GGACAATGGACTGCCCCCTACGG No data
1141740263_1141740276 19 Left 1141740263 16:85887051-85887073 CCCACCAAACCATGACCAACTTG No data
Right 1141740276 16:85887093-85887115 ACAATGGACTGCCCCCTACGGGG No data
1141740263_1141740275 18 Left 1141740263 16:85887051-85887073 CCCACCAAACCATGACCAACTTG No data
Right 1141740275 16:85887092-85887114 GACAATGGACTGCCCCCTACGGG No data
1141740263_1141740273 3 Left 1141740263 16:85887051-85887073 CCCACCAAACCATGACCAACTTG No data
Right 1141740273 16:85887077-85887099 TCTCTGGGGACGCTGGACAATGG No data
1141740263_1141740272 -4 Left 1141740263 16:85887051-85887073 CCCACCAAACCATGACCAACTTG No data
Right 1141740272 16:85887070-85887092 CTTGTGGTCTCTGGGGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141740263 Original CRISPR CAAGTTGGTCATGGTTTGGT GGG (reversed) Intergenic
No off target data available for this crispr