ID: 1141740267

View in Genome Browser
Species Human (GRCh38)
Location 16:85887060-85887082
Sequence CAGAGACCACAAGTTGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141740267_1141740276 10 Left 1141740267 16:85887060-85887082 CCATGACCAACTTGTGGTCTCTG No data
Right 1141740276 16:85887093-85887115 ACAATGGACTGCCCCCTACGGGG No data
1141740267_1141740275 9 Left 1141740267 16:85887060-85887082 CCATGACCAACTTGTGGTCTCTG No data
Right 1141740275 16:85887092-85887114 GACAATGGACTGCCCCCTACGGG No data
1141740267_1141740281 28 Left 1141740267 16:85887060-85887082 CCATGACCAACTTGTGGTCTCTG No data
Right 1141740281 16:85887111-85887133 CGGGGACACCTCCCCCGTTCAGG No data
1141740267_1141740273 -6 Left 1141740267 16:85887060-85887082 CCATGACCAACTTGTGGTCTCTG No data
Right 1141740273 16:85887077-85887099 TCTCTGGGGACGCTGGACAATGG No data
1141740267_1141740274 8 Left 1141740267 16:85887060-85887082 CCATGACCAACTTGTGGTCTCTG No data
Right 1141740274 16:85887091-85887113 GGACAATGGACTGCCCCCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141740267 Original CRISPR CAGAGACCACAAGTTGGTCA TGG (reversed) Intergenic
No off target data available for this crispr