ID: 1141740268

View in Genome Browser
Species Human (GRCh38)
Location 16:85887061-85887083
Sequence CATGACCAACTTGTGGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141740254_1141740268 29 Left 1141740254 16:85887009-85887031 CCTTGGGCACCGGGCAAAGCCTT No data
Right 1141740268 16:85887061-85887083 CATGACCAACTTGTGGTCTCTGG No data
1141740262_1141740268 -10 Left 1141740262 16:85887048-85887070 CCTCCCACCAAACCATGACCAAC No data
Right 1141740268 16:85887061-85887083 CATGACCAACTTGTGGTCTCTGG No data
1141740259_1141740268 -2 Left 1141740259 16:85887040-85887062 CCTCGGCCCCTCCCACCAAACCA No data
Right 1141740268 16:85887061-85887083 CATGACCAACTTGTGGTCTCTGG No data
1141740258_1141740268 4 Left 1141740258 16:85887034-85887056 CCTAAACCTCGGCCCCTCCCACC No data
Right 1141740268 16:85887061-85887083 CATGACCAACTTGTGGTCTCTGG No data
1141740261_1141740268 -9 Left 1141740261 16:85887047-85887069 CCCTCCCACCAAACCATGACCAA No data
Right 1141740268 16:85887061-85887083 CATGACCAACTTGTGGTCTCTGG No data
1141740255_1141740268 20 Left 1141740255 16:85887018-85887040 CCGGGCAAAGCCTTGTCCTAAAC No data
Right 1141740268 16:85887061-85887083 CATGACCAACTTGTGGTCTCTGG No data
1141740257_1141740268 10 Left 1141740257 16:85887028-85887050 CCTTGTCCTAAACCTCGGCCCCT No data
Right 1141740268 16:85887061-85887083 CATGACCAACTTGTGGTCTCTGG No data
1141740260_1141740268 -8 Left 1141740260 16:85887046-85887068 CCCCTCCCACCAAACCATGACCA No data
Right 1141740268 16:85887061-85887083 CATGACCAACTTGTGGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141740268 Original CRISPR CATGACCAACTTGTGGTCTC TGG Intergenic
No off target data available for this crispr