ID: 1141740270

View in Genome Browser
Species Human (GRCh38)
Location 16:85887063-85887085
Sequence TGACCAACTTGTGGTCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141740259_1141740270 0 Left 1141740259 16:85887040-85887062 CCTCGGCCCCTCCCACCAAACCA No data
Right 1141740270 16:85887063-85887085 TGACCAACTTGTGGTCTCTGGGG No data
1141740257_1141740270 12 Left 1141740257 16:85887028-85887050 CCTTGTCCTAAACCTCGGCCCCT No data
Right 1141740270 16:85887063-85887085 TGACCAACTTGTGGTCTCTGGGG No data
1141740258_1141740270 6 Left 1141740258 16:85887034-85887056 CCTAAACCTCGGCCCCTCCCACC No data
Right 1141740270 16:85887063-85887085 TGACCAACTTGTGGTCTCTGGGG No data
1141740262_1141740270 -8 Left 1141740262 16:85887048-85887070 CCTCCCACCAAACCATGACCAAC No data
Right 1141740270 16:85887063-85887085 TGACCAACTTGTGGTCTCTGGGG No data
1141740260_1141740270 -6 Left 1141740260 16:85887046-85887068 CCCCTCCCACCAAACCATGACCA No data
Right 1141740270 16:85887063-85887085 TGACCAACTTGTGGTCTCTGGGG No data
1141740255_1141740270 22 Left 1141740255 16:85887018-85887040 CCGGGCAAAGCCTTGTCCTAAAC No data
Right 1141740270 16:85887063-85887085 TGACCAACTTGTGGTCTCTGGGG No data
1141740261_1141740270 -7 Left 1141740261 16:85887047-85887069 CCCTCCCACCAAACCATGACCAA No data
Right 1141740270 16:85887063-85887085 TGACCAACTTGTGGTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141740270 Original CRISPR TGACCAACTTGTGGTCTCTG GGG Intergenic
No off target data available for this crispr