ID: 1141740271

View in Genome Browser
Species Human (GRCh38)
Location 16:85887066-85887088
Sequence CGTCCCCAGAGACCACAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141740271_1141740276 4 Left 1141740271 16:85887066-85887088 CCAACTTGTGGTCTCTGGGGACG No data
Right 1141740276 16:85887093-85887115 ACAATGGACTGCCCCCTACGGGG No data
1141740271_1141740274 2 Left 1141740271 16:85887066-85887088 CCAACTTGTGGTCTCTGGGGACG No data
Right 1141740274 16:85887091-85887113 GGACAATGGACTGCCCCCTACGG No data
1141740271_1141740281 22 Left 1141740271 16:85887066-85887088 CCAACTTGTGGTCTCTGGGGACG No data
Right 1141740281 16:85887111-85887133 CGGGGACACCTCCCCCGTTCAGG No data
1141740271_1141740275 3 Left 1141740271 16:85887066-85887088 CCAACTTGTGGTCTCTGGGGACG No data
Right 1141740275 16:85887092-85887114 GACAATGGACTGCCCCCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141740271 Original CRISPR CGTCCCCAGAGACCACAAGT TGG (reversed) Intergenic
No off target data available for this crispr