ID: 1141740273

View in Genome Browser
Species Human (GRCh38)
Location 16:85887077-85887099
Sequence TCTCTGGGGACGCTGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141740259_1141740273 14 Left 1141740259 16:85887040-85887062 CCTCGGCCCCTCCCACCAAACCA No data
Right 1141740273 16:85887077-85887099 TCTCTGGGGACGCTGGACAATGG No data
1141740263_1141740273 3 Left 1141740263 16:85887051-85887073 CCCACCAAACCATGACCAACTTG No data
Right 1141740273 16:85887077-85887099 TCTCTGGGGACGCTGGACAATGG No data
1141740264_1141740273 2 Left 1141740264 16:85887052-85887074 CCACCAAACCATGACCAACTTGT No data
Right 1141740273 16:85887077-85887099 TCTCTGGGGACGCTGGACAATGG No data
1141740266_1141740273 -1 Left 1141740266 16:85887055-85887077 CCAAACCATGACCAACTTGTGGT No data
Right 1141740273 16:85887077-85887099 TCTCTGGGGACGCTGGACAATGG No data
1141740267_1141740273 -6 Left 1141740267 16:85887060-85887082 CCATGACCAACTTGTGGTCTCTG No data
Right 1141740273 16:85887077-85887099 TCTCTGGGGACGCTGGACAATGG No data
1141740261_1141740273 7 Left 1141740261 16:85887047-85887069 CCCTCCCACCAAACCATGACCAA No data
Right 1141740273 16:85887077-85887099 TCTCTGGGGACGCTGGACAATGG No data
1141740262_1141740273 6 Left 1141740262 16:85887048-85887070 CCTCCCACCAAACCATGACCAAC No data
Right 1141740273 16:85887077-85887099 TCTCTGGGGACGCTGGACAATGG No data
1141740258_1141740273 20 Left 1141740258 16:85887034-85887056 CCTAAACCTCGGCCCCTCCCACC No data
Right 1141740273 16:85887077-85887099 TCTCTGGGGACGCTGGACAATGG No data
1141740260_1141740273 8 Left 1141740260 16:85887046-85887068 CCCCTCCCACCAAACCATGACCA No data
Right 1141740273 16:85887077-85887099 TCTCTGGGGACGCTGGACAATGG No data
1141740257_1141740273 26 Left 1141740257 16:85887028-85887050 CCTTGTCCTAAACCTCGGCCCCT No data
Right 1141740273 16:85887077-85887099 TCTCTGGGGACGCTGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141740273 Original CRISPR TCTCTGGGGACGCTGGACAA TGG Intergenic
No off target data available for this crispr