ID: 1141740275

View in Genome Browser
Species Human (GRCh38)
Location 16:85887092-85887114
Sequence GACAATGGACTGCCCCCTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141740264_1141740275 17 Left 1141740264 16:85887052-85887074 CCACCAAACCATGACCAACTTGT No data
Right 1141740275 16:85887092-85887114 GACAATGGACTGCCCCCTACGGG No data
1141740259_1141740275 29 Left 1141740259 16:85887040-85887062 CCTCGGCCCCTCCCACCAAACCA No data
Right 1141740275 16:85887092-85887114 GACAATGGACTGCCCCCTACGGG No data
1141740267_1141740275 9 Left 1141740267 16:85887060-85887082 CCATGACCAACTTGTGGTCTCTG No data
Right 1141740275 16:85887092-85887114 GACAATGGACTGCCCCCTACGGG No data
1141740266_1141740275 14 Left 1141740266 16:85887055-85887077 CCAAACCATGACCAACTTGTGGT No data
Right 1141740275 16:85887092-85887114 GACAATGGACTGCCCCCTACGGG No data
1141740262_1141740275 21 Left 1141740262 16:85887048-85887070 CCTCCCACCAAACCATGACCAAC No data
Right 1141740275 16:85887092-85887114 GACAATGGACTGCCCCCTACGGG No data
1141740260_1141740275 23 Left 1141740260 16:85887046-85887068 CCCCTCCCACCAAACCATGACCA No data
Right 1141740275 16:85887092-85887114 GACAATGGACTGCCCCCTACGGG No data
1141740263_1141740275 18 Left 1141740263 16:85887051-85887073 CCCACCAAACCATGACCAACTTG No data
Right 1141740275 16:85887092-85887114 GACAATGGACTGCCCCCTACGGG No data
1141740261_1141740275 22 Left 1141740261 16:85887047-85887069 CCCTCCCACCAAACCATGACCAA No data
Right 1141740275 16:85887092-85887114 GACAATGGACTGCCCCCTACGGG No data
1141740271_1141740275 3 Left 1141740271 16:85887066-85887088 CCAACTTGTGGTCTCTGGGGACG No data
Right 1141740275 16:85887092-85887114 GACAATGGACTGCCCCCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141740275 Original CRISPR GACAATGGACTGCCCCCTAC GGG Intergenic
No off target data available for this crispr