ID: 1141740281

View in Genome Browser
Species Human (GRCh38)
Location 16:85887111-85887133
Sequence CGGGGACACCTCCCCCGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141740271_1141740281 22 Left 1141740271 16:85887066-85887088 CCAACTTGTGGTCTCTGGGGACG No data
Right 1141740281 16:85887111-85887133 CGGGGACACCTCCCCCGTTCAGG No data
1141740267_1141740281 28 Left 1141740267 16:85887060-85887082 CCATGACCAACTTGTGGTCTCTG No data
Right 1141740281 16:85887111-85887133 CGGGGACACCTCCCCCGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141740281 Original CRISPR CGGGGACACCTCCCCCGTTC AGG Intergenic
No off target data available for this crispr