ID: 1141743811

View in Genome Browser
Species Human (GRCh38)
Location 16:85912768-85912790
Sequence TGAACAGTGATGCTGGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141743811_1141743814 9 Left 1141743811 16:85912768-85912790 CCTTTGGCCAGCATCACTGTTCA 0: 1
1: 0
2: 2
3: 14
4: 165
Right 1141743814 16:85912800-85912822 CAGAGCTTGTCTGCGTGTCCAGG 0: 1
1: 0
2: 1
3: 5
4: 120
1141743811_1141743816 18 Left 1141743811 16:85912768-85912790 CCTTTGGCCAGCATCACTGTTCA 0: 1
1: 0
2: 2
3: 14
4: 165
Right 1141743816 16:85912809-85912831 TCTGCGTGTCCAGGGCGTTGAGG 0: 1
1: 0
2: 0
3: 11
4: 89
1141743811_1141743815 10 Left 1141743811 16:85912768-85912790 CCTTTGGCCAGCATCACTGTTCA 0: 1
1: 0
2: 2
3: 14
4: 165
Right 1141743815 16:85912801-85912823 AGAGCTTGTCTGCGTGTCCAGGG 0: 1
1: 0
2: 0
3: 10
4: 97
1141743811_1141743818 26 Left 1141743811 16:85912768-85912790 CCTTTGGCCAGCATCACTGTTCA 0: 1
1: 0
2: 2
3: 14
4: 165
Right 1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG 0: 1
1: 0
2: 0
3: 6
4: 118
1141743811_1141743817 19 Left 1141743811 16:85912768-85912790 CCTTTGGCCAGCATCACTGTTCA 0: 1
1: 0
2: 2
3: 14
4: 165
Right 1141743817 16:85912810-85912832 CTGCGTGTCCAGGGCGTTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141743811 Original CRISPR TGAACAGTGATGCTGGCCAA AGG (reversed) Intronic
901115130 1:6837355-6837377 TGTCCAGAGAGGCTGGCCAAGGG + Intronic
902416272 1:16241592-16241614 TAAACACTGCTGCTGGGCAAAGG + Intergenic
902851804 1:19164367-19164389 GCAACAGAGATGCTGGCCAACGG - Exonic
906145274 1:43556945-43556967 CAATCAGTGATGCTGGCCCAGGG - Intronic
906166950 1:43693705-43693727 TGAACAGAGCTGCAGGCTAATGG - Intronic
906528436 1:46509831-46509853 TGAACAGAGAGCCTGGCTAAGGG - Intronic
910051352 1:82977905-82977927 TGAGCAGTGATGATGACCAGAGG + Intergenic
910573853 1:88736797-88736819 GAAACAGTGATAGTGGCCAAGGG - Intronic
913520704 1:119643265-119643287 GGAACACTGTTGCTGGCCTATGG + Intronic
915521547 1:156447963-156447985 GGAACAGTGAGGCTGGCCTAAGG + Intergenic
915624073 1:157103987-157104009 TGAACATTTACACTGGCCAAGGG - Intergenic
919788792 1:201276911-201276933 AGAACAGCACTGCTGGCCAAGGG + Intergenic
919840616 1:201606441-201606463 TGAACTGTGAGGCTGTCCTAAGG + Intergenic
921839234 1:219810829-219810851 TACACAGTGATGGTGGCCATTGG - Intronic
922774195 1:228207447-228207469 TTAGCAGTGATGCGGGCCAGGGG - Intronic
923456333 1:234168699-234168721 AGAACAGTGAGGCTGGGCAGTGG + Intronic
924669718 1:246111232-246111254 TCACCAGTGATGCTCTCCAAGGG + Intronic
924918297 1:248597742-248597764 TGAAGAATGATGCTGTCCACAGG + Intergenic
1062888209 10:1035680-1035702 TGAGCAGAGAGGCTGGGCAATGG - Intergenic
1065999887 10:31094698-31094720 TGATTAGTGATGCCGGCCATGGG - Intergenic
1066976804 10:42376757-42376779 TGAGCAGTGAGGATGACCAAGGG + Intergenic
1068665012 10:59664488-59664510 TGAAAAATGAGGCTGCCCAATGG - Intronic
1070604048 10:77886042-77886064 TCAACAGAGCTTCTGGCCAATGG + Intronic
1070692527 10:78537937-78537959 TGAACAAAGATGCCAGCCAAGGG - Intergenic
1080892234 11:36419011-36419033 TGAAGAGGGCAGCTGGCCAAAGG - Intronic
1083283182 11:61640132-61640154 TGAGCAGTGAGGCTGACCAGAGG - Intergenic
1086312442 11:85549759-85549781 TGAGCAGTGAGGATGACCAAAGG - Intronic
1087397661 11:97622079-97622101 TGACCAGAGATTCTGGCCCATGG - Intergenic
1087766287 11:102158543-102158565 TGCTCAGTGCTGCTGGCCCAAGG + Intronic
1088733746 11:112707910-112707932 GCAACAGTGATTCTGGCTAATGG + Intergenic
1089280528 11:117371192-117371214 TGAGCAGTGCTGTTGGCAAAGGG + Exonic
1090032442 11:123218718-123218740 TGAGCAGTGAAGATGGCCAGAGG - Intergenic
1090537271 11:127657134-127657156 TGATTAATGATGCTGGCTAATGG + Intergenic
1093924086 12:24891295-24891317 TGAACAGTGAGGATGACCAGAGG - Intronic
1095808801 12:46349900-46349922 TGAACAGGGTTGCAAGCCAAGGG + Intergenic
1096007043 12:48182165-48182187 TGAAGAGTGAGGCTGGCCCAGGG - Intergenic
1096104872 12:48991316-48991338 TGACCAGTGAGGCTGTCCCAAGG + Intergenic
1096461610 12:51824547-51824569 TGAGAGGTGATGCTGGCCACTGG + Intergenic
1096525661 12:52208633-52208655 GGTACAGTGAGGCTGGCCACTGG + Intergenic
1097087030 12:56476468-56476490 TGAACCATCATGCTGGCCAATGG - Exonic
1098661188 12:73095703-73095725 AGGACAGTGGTGCTGGCAAAGGG - Intergenic
1099706109 12:86154601-86154623 TGCACAGTGAATCTGCCCAACGG + Intronic
1100701318 12:97151595-97151617 TGAGCAGTGAGGATGACCAAAGG + Intergenic
1100946966 12:99796193-99796215 AGCACAGAGATGCTGGACAAAGG + Intronic
1101297655 12:103441055-103441077 TTAAAAATGATGCTGGCCATAGG - Intronic
1102773733 12:115501052-115501074 GGAACAGTGTTTCTGGCAAAGGG + Intergenic
1106464717 13:30002888-30002910 AGAACAGTGGTGGTGGCCAGGGG + Intergenic
1108860766 13:54856018-54856040 TCAACAGTAATGATGGCAAAGGG + Intergenic
1111704110 13:91726632-91726654 AGAACAGTGATGATGGGCAAAGG - Intronic
1113354998 13:109570518-109570540 TGAACATTGATGCTGCCAAGAGG - Intergenic
1119735676 14:76980292-76980314 TGAGCAGTGAGGATGGCCAGAGG - Intergenic
1121610486 14:95275376-95275398 TGAGCAGTCAGGATGGCCAAAGG - Intronic
1121622923 14:95362692-95362714 TGCACAGATAGGCTGGCCAAAGG - Intergenic
1121686647 14:95840337-95840359 GGCAGGGTGATGCTGGCCAAAGG + Intergenic
1121984842 14:98495103-98495125 TCAACATTGATGCTTTCCAAAGG + Intergenic
1124989401 15:34656416-34656438 TGAACAGTGAGGATGACCAGAGG - Intergenic
1128342034 15:66829201-66829223 TGAACAGTGAGGATGACCAAAGG - Intergenic
1128373664 15:67059828-67059850 TGAACAGTGCTGGAAGCCAAAGG + Intergenic
1130835221 15:87643916-87643938 TGAGCAGGGATTCTGGCCCATGG + Intergenic
1131113913 15:89782512-89782534 TGAGCAGTGAGGATGACCAAAGG - Intergenic
1132938919 16:2497339-2497361 TGAAAGCTGATGCTGGCCATGGG + Intronic
1133061867 16:3180101-3180123 TGGGCAGTGTTGCTGGACAAGGG + Intergenic
1133532518 16:6668295-6668317 TGATTAGTGATGCCTGCCAAGGG + Intronic
1133625672 16:7568451-7568473 TGAACAGTGAGGATGACCAGAGG + Intronic
1134025341 16:10948969-10948991 TGAACTGTCACTCTGGCCAAAGG + Intronic
1135187791 16:20330082-20330104 TGAAGAGTGATGCAGGCTGAGGG - Intergenic
1135409278 16:22220897-22220919 TCAGCAGGGATTCTGGCCAAGGG + Intronic
1138469981 16:57226637-57226659 TGAACAGTGAAGATGACCAGAGG + Intronic
1138837637 16:60457893-60457915 TGAACAGTAATGCTTGACATTGG + Intergenic
1139135669 16:64201621-64201643 TGAACAATGATTCTGGCATAGGG + Intergenic
1141648600 16:85380410-85380432 TGAACAGTGGGGTTGGCCAAGGG - Intergenic
1141743811 16:85912768-85912790 TGAACAGTGATGCTGGCCAAAGG - Intronic
1142133717 16:88442345-88442367 GGAACAGTGTTCCTGGCAAAGGG - Intergenic
1148485863 17:47990614-47990636 TGAAAAGTGATTCTGGACACTGG - Intergenic
1150350067 17:64437482-64437504 TGAGCAGTGAGGATGGCCAGAGG - Intergenic
1152182502 17:78832447-78832469 TTCACAGTGATACTGGCCCATGG + Intronic
1157313756 18:46571828-46571850 TGAGCAGTAATGCTGGCCAATGG - Intronic
1165619150 19:37229976-37229998 TGCACTGTGTTCCTGGCCAAAGG + Intronic
927960536 2:27238346-27238368 TGAGCAGGGATGTTGGCCATTGG + Intronic
928673159 2:33622735-33622757 TGAACAGTTATTCTGGAAAACGG + Intergenic
937518297 2:122680957-122680979 TTAAAAGTGATACTGACCAATGG + Intergenic
938550219 2:132373477-132373499 TGAGCAGTGAGGCTGACCAGAGG + Intergenic
939538743 2:143465994-143466016 TGAACAGTGATGGTTTACAATGG + Intronic
942154740 2:173116400-173116422 TGCAGGGAGATGCTGGCCAAAGG - Intronic
946440071 2:219687595-219687617 TGAGCAGTGATGATGACCAGAGG + Intergenic
948245830 2:236485081-236485103 TGAATAGTGAAACTGACCAAAGG - Intronic
1170487186 20:16830229-16830251 TGAACAGCAAAGCAGGCCAAGGG - Intergenic
1171424614 20:25041843-25041865 TGAACAGCTGTGGTGGCCAAAGG + Intronic
1172207718 20:33176321-33176343 GAAAGAGTGATGCTGGCCGATGG + Intronic
1172878845 20:38184266-38184288 TAAACTGTTCTGCTGGCCAAAGG - Intergenic
1173697834 20:45036368-45036390 TGCACAGATATGCTGGACAAAGG - Intronic
1177801317 21:25831614-25831636 TGAACAGTGAGGATGCCCACAGG - Intergenic
1178506943 21:33170156-33170178 TGAACCTAGATGTTGGCCAAGGG - Exonic
1178672737 21:34606178-34606200 TGAACAGTGATTCTGAGAAATGG + Intronic
1179432157 21:41329371-41329393 AGCACAGAGATGCTGGACAAAGG - Intronic
1181369449 22:22404720-22404742 TGCACAGTGCTCCAGGCCAATGG + Intergenic
1182692472 22:32173649-32173671 TGGACAGTGATGCTGGGAAAAGG - Intergenic
950780465 3:15387281-15387303 TGAACAGTGAGGATGACCAGAGG + Intronic
952340066 3:32438018-32438040 TTCAAAGTGATGCTGTCCAAAGG - Intronic
952767814 3:36970176-36970198 TCATCTGTGATGCTGGCTAAGGG + Intergenic
952838144 3:37621740-37621762 TGAGCACTGATGCTTGCCAAAGG + Intronic
953153969 3:40352127-40352149 TGAGCAGTGAGGATGACCAAAGG - Intergenic
954320450 3:49829081-49829103 AGAACAGTGAGTCTGACCAATGG - Exonic
954878806 3:53820383-53820405 TGAACAGGGGTTCTGGCCACTGG - Intronic
955083635 3:55680751-55680773 AGAACAATGAGGCTGGCCACAGG + Intronic
955595088 3:60580840-60580862 TGATGAGTGATGCCTGCCAAGGG + Intronic
963591891 3:147270439-147270461 TGGACAGTGGTGATGGCCAGAGG + Intergenic
964266094 3:154897075-154897097 AGAACCGTGCTGCTTGCCAAAGG + Intergenic
965827184 3:172743030-172743052 TGCAAAGTGATGGTGGCCCAAGG + Intergenic
968439192 4:612987-613009 AGCACAGTGATGCAGGGCAAGGG - Intergenic
969312542 4:6362297-6362319 TGAAGAGGGAAGCAGGCCAAAGG + Intronic
970554705 4:17219783-17219805 TGAAAAGTGATGGGGGACAAGGG - Intergenic
972676490 4:41264701-41264723 AGAAAAGTGATTCTGGGCAAAGG + Intronic
973050004 4:45585137-45585159 TGAACAGGCATGCTGACCAGAGG - Intergenic
973143524 4:46797220-46797242 TGTACAGTTATTCTGGCAAAGGG - Intronic
974721478 4:65744437-65744459 TGAGCAGTGAGGATGGCCAGAGG - Intergenic
975399300 4:73916231-73916253 TGAATATTGATGATGGCCTAAGG + Intergenic
977501548 4:97846087-97846109 TGAATACTGAAGCAGGCCAAAGG + Intronic
978364174 4:107963221-107963243 TCATCAGTGATGTTGGCCTATGG - Intergenic
979013051 4:115395913-115395935 TTAGCAGTGATTGTGGCCAAGGG + Intergenic
979342595 4:119544163-119544185 TGAACATTGATGGTGGTAAAGGG - Intronic
980400268 4:132275382-132275404 TGAACAGGAATGGTGGCAAAAGG - Intergenic
980976634 4:139617195-139617217 TGAGCCATCATGCTGGCCAAAGG + Intergenic
985694282 5:1331212-1331234 GGACCAGTGTTCCTGGCCAAGGG - Intronic
985992159 5:3572177-3572199 GGAAAAGAGATACTGGCCAAAGG + Intergenic
986342736 5:6805099-6805121 TGAACAGTGATGTTGGCAAAAGG + Intergenic
988228591 5:28446757-28446779 TGCACAGTGACCCTGGCAAAAGG - Intergenic
988569271 5:32348146-32348168 TGAGCAGTGAGGATGACCAAAGG - Intergenic
989585540 5:43071566-43071588 TGCACAGTCATGGTGGCCACAGG + Intronic
994026822 5:95093986-95094008 TGAAAAGTGGTGCTGGCCATTGG - Intronic
998275033 5:140744362-140744384 TGAGCAGTGAGGATGACCAAAGG + Intergenic
998437810 5:142128078-142128100 TGCACAGAGATGTTGGGCAAGGG - Intronic
998478859 5:142444822-142444844 TGAACAGAGAGGGTGGCCAGAGG + Intergenic
999937126 5:156499594-156499616 GGAAGAGTATTGCTGGCCAAGGG + Intronic
1000213290 5:159130269-159130291 TAAACAGTGACACTGGCCGAAGG + Intergenic
1003153638 6:3573071-3573093 TGACCAGTGATCCTTGTCAAAGG + Intergenic
1005285026 6:24316048-24316070 TGGACAGTGATGCTGTCTACTGG + Intronic
1007688654 6:43683165-43683187 TGAACAGTGGAGCTTGCCATGGG - Intronic
1009864938 6:69385782-69385804 TGAACCGTGGAGCTGTCCAAAGG - Intronic
1010157529 6:72812107-72812129 TGAGCAGTGAAGATGACCAAAGG + Intronic
1010541110 6:77093543-77093565 TGTTCAGTGTTGCTGGACAAAGG - Intergenic
1012239568 6:96856784-96856806 TTAACAGAGATGGTGGCAAAGGG - Intergenic
1012351519 6:98257161-98257183 TGAAGAGTTATGATGGCAAATGG - Intergenic
1016288895 6:142506440-142506462 TTAGCAGTGATTGTGGCCAAGGG + Intergenic
1016817846 6:148320033-148320055 AGAGCAGTGATGCTGGCATATGG + Intronic
1018543030 6:164904101-164904123 TAAGCAGTGATTATGGCCAAAGG - Intergenic
1021973288 7:25985528-25985550 TGAAGAGTGAGGCTGGCCCAGGG - Intergenic
1023128842 7:36982486-36982508 TTTACATTGATGCTGTCCAATGG - Intronic
1023679047 7:42664810-42664832 TAAAAACTGATGGTGGCCAATGG + Intergenic
1024981853 7:55163881-55163903 CGAACAGTGATGATGGCCCAGGG + Intronic
1026274395 7:68864013-68864035 TGAACAGTGAGGATGACCAGAGG + Intergenic
1026800181 7:73395460-73395482 TGAGCAGTGAGGGTGGCCAGAGG + Intergenic
1030192088 7:106820302-106820324 TGCACAGTTATGCTGGTAAAAGG - Intergenic
1031991801 7:128203370-128203392 TGAACAGAGGTGATGGCCAAGGG + Intergenic
1033015367 7:137665409-137665431 TGAACAGCAAAGCTGCCCAAGGG - Intronic
1035024125 7:155815319-155815341 TCAGCAGGGATGCTGGGCAAGGG - Intergenic
1036501837 8:9321225-9321247 TGAAGAGTGAGGCTGGGAAAAGG - Intergenic
1039827522 8:41187640-41187662 TGAACAGTGAGGATGACCAGAGG + Intergenic
1042047778 8:64673278-64673300 TGAACAGAGCTGAAGGCCAAGGG - Intronic
1044574345 8:93752030-93752052 TGAGCAGTGAGGATGGCCAGAGG + Intergenic
1046975327 8:120269414-120269436 TGTACACTAATGCTAGCCAAGGG - Intronic
1048181010 8:132194253-132194275 AGATCAGTAATGGTGGCCAAGGG - Intronic
1048670692 8:136716285-136716307 TGAACATAGTTGCTGGCCTATGG + Intergenic
1049023040 8:139970803-139970825 TGTACTGTGATCCTGGACAAAGG - Intronic
1051772573 9:20594725-20594747 TGAGCAGTGAGGATGACCAAAGG - Intronic
1052525185 9:29608394-29608416 TCAACAGTGATACAGGCCAGAGG - Intergenic
1057217416 9:93236741-93236763 TGGTCACTGCTGCTGGCCAAGGG - Intronic
1060016064 9:120087524-120087546 TGAACACTGTTGCTGGCAAATGG + Intergenic
1062689944 9:137836497-137836519 TGAACAGCGAGGCCGGACAAGGG + Intronic
1185955505 X:4484579-4484601 TGAGCAGTGAGGATGGCCAGAGG - Intergenic
1186306724 X:8268404-8268426 AGAAGAGGGAAGCTGGCCAAGGG + Intergenic
1186364355 X:8875580-8875602 TGAGCTGTGAGGCTGGCCTAAGG - Intergenic
1188863998 X:35291965-35291987 TGAACATGGATGGTAGCCAAGGG + Intergenic
1190327951 X:49218385-49218407 TGATCAGTGATCCTGGCCCCAGG + Intronic
1191616994 X:63180537-63180559 TGAACAGTGAGGATGACCAGAGG - Intergenic
1191619303 X:63198386-63198408 TGAACAGTGAGGATGACCAGAGG + Intergenic
1191636607 X:63384542-63384564 TGAACAGTGAGGATGACCAGAGG + Intergenic
1192422224 X:71043950-71043972 TGCTCAGGGATGCTGGGCAAAGG - Intergenic
1193738121 X:85185242-85185264 TTACCAGTGATGGTGGCCACAGG - Intergenic
1195090034 X:101450131-101450153 TTATCAGTGGTGCTGGCCACAGG - Intronic
1196132141 X:112168569-112168591 TGAACAGTGAGGATGACCAGAGG - Intergenic
1197464515 X:126786070-126786092 TGAGCAGTGAGGATGACCAAAGG + Intergenic