ID: 1141743813

View in Genome Browser
Species Human (GRCh38)
Location 16:85912775-85912797
Sequence ACACCAGTGAACAGTGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 177}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141743813_1141743815 3 Left 1141743813 16:85912775-85912797 CCAGCATCACTGTTCACTGGTGT 0: 1
1: 0
2: 0
3: 6
4: 177
Right 1141743815 16:85912801-85912823 AGAGCTTGTCTGCGTGTCCAGGG 0: 1
1: 0
2: 0
3: 10
4: 97
1141743813_1141743818 19 Left 1141743813 16:85912775-85912797 CCAGCATCACTGTTCACTGGTGT 0: 1
1: 0
2: 0
3: 6
4: 177
Right 1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG 0: 1
1: 0
2: 0
3: 6
4: 118
1141743813_1141743814 2 Left 1141743813 16:85912775-85912797 CCAGCATCACTGTTCACTGGTGT 0: 1
1: 0
2: 0
3: 6
4: 177
Right 1141743814 16:85912800-85912822 CAGAGCTTGTCTGCGTGTCCAGG 0: 1
1: 0
2: 1
3: 5
4: 120
1141743813_1141743817 12 Left 1141743813 16:85912775-85912797 CCAGCATCACTGTTCACTGGTGT 0: 1
1: 0
2: 0
3: 6
4: 177
Right 1141743817 16:85912810-85912832 CTGCGTGTCCAGGGCGTTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 95
1141743813_1141743820 28 Left 1141743813 16:85912775-85912797 CCAGCATCACTGTTCACTGGTGT 0: 1
1: 0
2: 0
3: 6
4: 177
Right 1141743820 16:85912826-85912848 TTGAGGGCAATTGGATAATCTGG No data
1141743813_1141743816 11 Left 1141743813 16:85912775-85912797 CCAGCATCACTGTTCACTGGTGT 0: 1
1: 0
2: 0
3: 6
4: 177
Right 1141743816 16:85912809-85912831 TCTGCGTGTCCAGGGCGTTGAGG 0: 1
1: 0
2: 0
3: 11
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141743813 Original CRISPR ACACCAGTGAACAGTGATGC TGG (reversed) Intronic