ID: 1141743813

View in Genome Browser
Species Human (GRCh38)
Location 16:85912775-85912797
Sequence ACACCAGTGAACAGTGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 177}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141743813_1141743816 11 Left 1141743813 16:85912775-85912797 CCAGCATCACTGTTCACTGGTGT 0: 1
1: 0
2: 0
3: 6
4: 177
Right 1141743816 16:85912809-85912831 TCTGCGTGTCCAGGGCGTTGAGG 0: 1
1: 0
2: 0
3: 11
4: 89
1141743813_1141743820 28 Left 1141743813 16:85912775-85912797 CCAGCATCACTGTTCACTGGTGT 0: 1
1: 0
2: 0
3: 6
4: 177
Right 1141743820 16:85912826-85912848 TTGAGGGCAATTGGATAATCTGG No data
1141743813_1141743817 12 Left 1141743813 16:85912775-85912797 CCAGCATCACTGTTCACTGGTGT 0: 1
1: 0
2: 0
3: 6
4: 177
Right 1141743817 16:85912810-85912832 CTGCGTGTCCAGGGCGTTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 95
1141743813_1141743815 3 Left 1141743813 16:85912775-85912797 CCAGCATCACTGTTCACTGGTGT 0: 1
1: 0
2: 0
3: 6
4: 177
Right 1141743815 16:85912801-85912823 AGAGCTTGTCTGCGTGTCCAGGG 0: 1
1: 0
2: 0
3: 10
4: 97
1141743813_1141743818 19 Left 1141743813 16:85912775-85912797 CCAGCATCACTGTTCACTGGTGT 0: 1
1: 0
2: 0
3: 6
4: 177
Right 1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG 0: 1
1: 0
2: 0
3: 6
4: 118
1141743813_1141743814 2 Left 1141743813 16:85912775-85912797 CCAGCATCACTGTTCACTGGTGT 0: 1
1: 0
2: 0
3: 6
4: 177
Right 1141743814 16:85912800-85912822 CAGAGCTTGTCTGCGTGTCCAGG 0: 1
1: 0
2: 1
3: 5
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141743813 Original CRISPR ACACCAGTGAACAGTGATGC TGG (reversed) Intronic
900516509 1:3084766-3084788 ACGCCCGAGAACAGTGAGGCTGG - Intronic
901120587 1:6889764-6889786 ACCCCTGTGACCAGAGATGCAGG + Intronic
901376675 1:8844608-8844630 CCACCAGTGACCAGGGAGGCGGG - Intergenic
905703125 1:40034035-40034057 ACACTAGTGAACTGAGGTGCTGG + Intergenic
906935698 1:50212353-50212375 ATATCAGTGAACTGTCATGCTGG + Intergenic
907941423 1:59091613-59091635 ACACCAGAGACCAGGGATCCAGG - Intergenic
911014707 1:93319961-93319983 AGACCAGTGAGAAGTGATGATGG - Intergenic
913106467 1:115618146-115618168 ACACTTGTGCACAGTGATCCAGG + Intergenic
915314471 1:155020320-155020342 ACTCCTGGCAACAGTGATGCAGG + Intronic
916613812 1:166419275-166419297 TCACCAGTTAAGAATGATGCTGG + Intergenic
919002799 1:191855674-191855696 ACACCAGAGTACAGGGATGGAGG - Intergenic
920848200 1:209611012-209611034 ACCCCAGTGCCCTGTGATGCTGG + Intronic
924850473 1:247824139-247824161 AATCCAGTGAACTCTGATGCTGG - Intergenic
924937318 1:248783215-248783237 ACACCAGGTAACATCGATGCAGG + Intergenic
1063877709 10:10497520-10497542 AAACCAGTGAAAAGTGCTACAGG + Intergenic
1065298863 10:24302769-24302791 ACACCAGGGAGCAGTGAGGGAGG + Intronic
1067059207 10:43069302-43069324 ACAACAATGAAGAGTGATGCAGG + Intergenic
1067163610 10:43847354-43847376 ACACCAGAGAACAGAGCTGGAGG - Intergenic
1071492080 10:86143097-86143119 ACACCTGAAATCAGTGATGCTGG + Intronic
1072086065 10:92080459-92080481 ACACCAATGAACAGTGTGGCAGG + Intronic
1072593691 10:96851377-96851399 GCAGCAGTGAACAGAGATGTGGG + Intronic
1075545081 10:123349011-123349033 ACACCAGGGAACCGTGGAGCAGG + Intergenic
1077762003 11:5111647-5111669 TCTCCAGTGATCAGTGATGTTGG + Intergenic
1078449792 11:11432232-11432254 ACACCAGTGAACAATCTTCCAGG + Intronic
1083395356 11:62387663-62387685 GCACCAGGGAAGAGTGATGGTGG - Intronic
1084959737 11:72710153-72710175 ACAGCAATGAACAGAGGTGCGGG + Intronic
1085025555 11:73234533-73234555 ACACCGGTGCACGCTGATGCAGG - Exonic
1085435295 11:76494155-76494177 ACACCTGTCAACAGTGAGCCAGG - Intronic
1086191725 11:84087390-84087412 TCACCAATGAATAATGATGCTGG + Intronic
1087107425 11:94424021-94424043 ACACCAAACAACAGTAATGCAGG + Intronic
1087251508 11:95905257-95905279 ACATCAGAGAACTGTGAGGCTGG - Intronic
1089032514 11:115347054-115347076 ACACCAGTAAACTAAGATGCGGG + Intronic
1089966595 11:122658636-122658658 ACAACAGTAAGCAGTGAAGCTGG + Intronic
1090351713 11:126112239-126112261 ACACCAGTGAGGAGAGATGTGGG - Intergenic
1092003265 12:5048390-5048412 ACAACAGGGAACTGAGATGCTGG - Intergenic
1096462052 12:51827222-51827244 ACTCCAATGATCAGTGATGCTGG + Intergenic
1097327809 12:58298807-58298829 ACATCAATGCACAGTGTTGCCGG + Intergenic
1097780716 12:63701310-63701332 ACATCAGTAAACTGTGAGGCAGG + Intergenic
1098542629 12:71674687-71674709 AAATCAGAGCACAGTGATGCTGG - Intronic
1098821147 12:75231833-75231855 ACACCACTCAACTGTGATCCTGG - Intergenic
1099883460 12:88498222-88498244 AAAACAGTGATCTGTGATGCTGG - Intronic
1102693576 12:114780742-114780764 ACACCATTGAAGAGTGACCCAGG + Intergenic
1104156424 12:126137070-126137092 ACAGCAGAGAAGAGTGAAGCTGG - Intergenic
1104894935 12:132159424-132159446 CCCCCAGAGAACAGTGCTGCAGG - Intergenic
1107743744 13:43482929-43482951 CCCCCATTGAACAGTGAGGCAGG - Intronic
1111679405 13:91425514-91425536 AGAACAGTGAACAGTGAAGGGGG - Intronic
1115716743 14:36113944-36113966 ACAACAGTGAACATTAATGCAGG + Intergenic
1116162487 14:41287728-41287750 ACACAAGAGGACTGTGATGCTGG + Intergenic
1118736218 14:68703459-68703481 CCTCGAGTGAAAAGTGATGCGGG - Intronic
1118777980 14:68985678-68985700 CCACCAGAGACCAGTGAGGCAGG + Intergenic
1118791234 14:69094883-69094905 ACACCAGTTAATTGTGATACAGG + Intronic
1118846743 14:69553196-69553218 ACACAAGAGAACAATGAAGCTGG - Intergenic
1119104507 14:71911546-71911568 ACACCAGTGAATTCAGATGCAGG + Intergenic
1121668482 14:95690743-95690765 CCACAAGTGCACTGTGATGCTGG - Exonic
1122199706 14:100114928-100114950 CCTCCAGTGAACGGTGCTGCTGG - Intronic
1123011619 14:105352559-105352581 ACCCCAGGGGACAGTGATGAGGG - Intronic
1123011776 14:105352969-105352991 ACCCCAGGGGACAGTGATGAGGG - Intronic
1123011810 14:105353062-105353084 ACCCCAGGGGACAGTGATGGGGG - Intronic
1123011824 14:105353094-105353116 ACCCCAGGGGACAGTGATGGGGG - Intronic
1123011848 14:105353158-105353180 ACCCCAGGGGACAGTGATGGGGG - Intronic
1123011900 14:105353285-105353307 ACCCCAGGGGACAGTGATGGGGG - Intronic
1123011924 14:105353347-105353369 ACCCCAGGGGACAGTGATGAGGG - Intronic
1123011937 14:105353379-105353401 ACCCCAGGGGACAGTGATGAGGG - Intronic
1123011950 14:105353411-105353433 ACCCCAGGGGACAGTGATGAGGG - Intronic
1123011962 14:105353442-105353464 ACCCCAGGGGACAGTGATGAGGG - Intronic
1123108574 14:105854734-105854756 ACCCCTGTGAACAGAGATGGTGG + Intergenic
1127099507 15:55550889-55550911 ACACCAGGGACCAGTGGTGGGGG + Intronic
1131563126 15:93461602-93461624 ACACCCCTGAACAGTGAGCCTGG - Intergenic
1136097273 16:27966089-27966111 ATGCGAGTGAACAGTGCTGCAGG - Intronic
1137886477 16:52109876-52109898 AAACCAGTGAACAGAGAAGTAGG + Intergenic
1140760397 16:78103881-78103903 ACACAAGTGAACCGTGAGGCAGG - Intronic
1141499809 16:84436283-84436305 ACAGCAATGCACAGTGCTGCCGG - Intronic
1141743813 16:85912775-85912797 ACACCAGTGAACAGTGATGCTGG - Intronic
1144992778 17:19245324-19245346 ACACCAGTGTGCAGAGCTGCAGG - Intronic
1148663652 17:49358185-49358207 AGACCAGTAAACAGTGGAGCGGG + Intronic
1150088300 17:62295282-62295304 AAACCAAAGAACAGTGAGGCTGG - Intergenic
1151409144 17:73909647-73909669 ACAACAGTGACCAGTGACTCTGG + Intergenic
1151624088 17:75265779-75265801 GCACCAGCGGACACTGATGCCGG + Exonic
1153358316 18:4163677-4163699 AAAACAGTGAACAGAAATGCTGG + Intronic
1153567986 18:6439356-6439378 AGAGCAGTGAACAGGGATGAAGG - Intergenic
1158700294 18:59739261-59739283 ACACCAGTCAACAGTCAGCCTGG + Intergenic
1161159043 19:2751563-2751585 ACACCTGTGGACACTGTTGCAGG - Intergenic
1161554204 19:4931253-4931275 ACACCAGTGGACACAGATGGTGG + Intronic
1167802170 19:51751164-51751186 AGGGCAGAGAACAGTGATGCAGG - Intronic
1168026907 19:53649136-53649158 GCACCAGTTAAGAGGGATGCAGG + Intergenic
925718602 2:6807438-6807460 ATACCTGTGAACAGTGTTACAGG - Intergenic
926295407 2:11565266-11565288 ACACCAGGCACCAGTGAGGCAGG - Intronic
926448692 2:12975576-12975598 ACACCATTGTACATTTATGCTGG + Intergenic
930645160 2:53898514-53898536 AGACAGGTGAACAGAGATGCTGG + Intronic
930705751 2:54503167-54503189 ACACCAGTGACCAGTGTCGTGGG - Intronic
931116458 2:59171845-59171867 GCAGCAGAGAACAGTGAGGCTGG + Intergenic
931550026 2:63433369-63433391 ATAACAGTGAACAGTGATTCAGG + Intronic
932919158 2:75889984-75890006 ACAACAGTTAATAGTGATGATGG + Intergenic
933164552 2:79061891-79061913 AGAGCAGTGAAGATTGATGCTGG + Intergenic
933862471 2:86483646-86483668 ACACCAGTCACCAGTGAAACAGG - Intronic
935842596 2:107129511-107129533 ACAGAAGACAACAGTGATGCAGG + Intergenic
937012406 2:118574180-118574202 ACACCACTGAACATTGCTCCAGG + Intergenic
937815966 2:126251217-126251239 ACAACAGTCATCAGTGATGATGG + Intergenic
939360164 2:141161291-141161313 ACAGCAGTGAACAGTCTTTCTGG + Intronic
940109304 2:150133894-150133916 ACACAAATGAACAGAGAAGCTGG - Intergenic
940858757 2:158751022-158751044 ACACCAGAGGAAAGGGATGCCGG - Intergenic
942545913 2:177063470-177063492 TCACCAGCCAACAGTGCTGCTGG - Intergenic
945120740 2:206454814-206454836 ACATCAGGGCACACTGATGCAGG + Intronic
1170437121 20:16341752-16341774 CCTCCAGGGAACTGTGATGCAGG + Intronic
1170797073 20:19557265-19557287 ACACCACTGCACAGACATGCTGG - Intronic
1172519222 20:35556522-35556544 ACCACAGAGAACAGTGAGGCAGG - Intronic
1175389327 20:58616346-58616368 ACACCAGCAATCAGAGATGCTGG - Intergenic
1175942880 20:62546036-62546058 CCACCGGGGCACAGTGATGCTGG + Intergenic
1178022796 21:28429188-28429210 ACAACAGTCAACAGAGAAGCAGG + Intergenic
1181388258 22:22559695-22559717 ATGCCAGTGAACAGAGCTGCGGG + Intronic
1182944144 22:34306183-34306205 AAACCAGTGACCAGTGTTGGGGG - Intergenic
1183267624 22:36838952-36838974 CCTCCAGAGAACAGGGATGCAGG + Intergenic
1183288215 22:36981301-36981323 ACTCAAGTGAACAGCGATGAGGG - Intergenic
1183747612 22:39700621-39700643 TCTCCTGTGAACAGTGATGAGGG + Intergenic
955602258 3:60658368-60658390 ACACAAGAAGACAGTGATGCAGG - Intronic
955908944 3:63839833-63839855 AAACAAATGAACAGTGATACTGG - Intronic
956151146 3:66244240-66244262 AGACCAGTGCACAATGATACTGG + Intronic
956657262 3:71564631-71564653 ACACCCTTGGCCAGTGATGCAGG + Intronic
956688609 3:71855689-71855711 AAACCAGTGAACAGTGACTGAGG - Intergenic
957511655 3:81196284-81196306 ACACCCGTGTACAGTTATACAGG + Intergenic
959659268 3:108847665-108847687 ACACAAGTGATAAGGGATGCTGG - Intronic
961481578 3:127184055-127184077 CCACCAGTGATCAGTGACACAGG - Intergenic
961540316 3:127594976-127594998 ACCCCAGCCAACAGTCATGCTGG - Intronic
963091850 3:141489690-141489712 ACCCCAGTGAAAAGTGAGGATGG + Intronic
965374124 3:167900735-167900757 ACACCAGGGTACAGTGATAAAGG - Intergenic
978795346 4:112703038-112703060 ACAACAGTGAAGAGTGCTCCAGG - Intergenic
978913377 4:114093250-114093272 ACACCATTGAACAGTCATTGAGG - Intergenic
980692417 4:136312373-136312395 TCCCCAGTGAACAGTGACTCAGG - Intergenic
982737605 4:159022536-159022558 ACACCAGGAGACTGTGATGCAGG - Intronic
987301705 5:16603507-16603529 AGAGCAGGGAACAGAGATGCAGG + Intronic
988876270 5:35450092-35450114 ACATCTGTGAACAATGATGATGG - Intergenic
991013405 5:61907446-61907468 TCACCAGTGAATAGGGATGAGGG + Intergenic
992546374 5:77817777-77817799 AAACCACTGGACTGTGATGCAGG - Intronic
997143177 5:131405059-131405081 AAACCAGTGGGCAGTGATGGAGG + Intergenic
998918445 5:147041462-147041484 GCACCAGGGAACAATGATGGTGG - Intronic
1001447687 5:171798503-171798525 ACATAAGGGAACAGGGATGCAGG + Intergenic
1001537189 5:172506429-172506451 GCAGCAGTGAACAGGGCTGCAGG - Intergenic
1002292319 5:178208371-178208393 ACTCCAGTGGACAGTGATAGAGG + Intronic
1006403519 6:33831284-33831306 ACACCTGTGGAGAGTGACGCAGG - Intergenic
1007492914 6:42237976-42237998 ACCTCAGTGAACACTGATGTAGG + Intronic
1007966780 6:46010617-46010639 ACACAAGTCATCAGGGATGCAGG + Intronic
1008489796 6:52074649-52074671 ACACCAGAGCACGGTGATGGGGG + Intronic
1009623099 6:66100766-66100788 ACAAAAGTGAACAGGAATGCAGG + Intergenic
1009807487 6:68620947-68620969 ACACCAGTTTACACTGATGATGG + Intergenic
1012574614 6:100777973-100777995 ATACAAGTGAAAGGTGATGCTGG + Intronic
1013466321 6:110420057-110420079 ACACCTTTTAACAGTGATTCAGG + Intergenic
1019329100 7:453986-454008 ACTCCAGGGAACAGCAATGCCGG - Intergenic
1019520255 7:1457725-1457747 ACACCAGTGATCCATGAAGCTGG + Intronic
1020682885 7:11258603-11258625 GCTCCAGAGAACAGTCATGCAGG + Intergenic
1022939300 7:35217362-35217384 ACATCAGTAAACTGTGAGGCAGG + Intronic
1023847374 7:44130006-44130028 GGACCAGTGAACAGTGAGTCTGG + Intergenic
1026246239 7:68622256-68622278 ACACCAGTGAAATGTCAGGCGGG + Intergenic
1027715895 7:81669389-81669411 ACACCAGTGAGCAAAGATGAAGG - Intergenic
1029628198 7:101733714-101733736 ACACCAGAGAAAGGAGATGCCGG + Intergenic
1030192092 7:106820309-106820331 TCCCCAGTGCACAGTTATGCTGG - Intergenic
1030597311 7:111555322-111555344 ACAGCAGTGAACTGTGGGGCAGG + Intronic
1030965223 7:115984329-115984351 ACAACTCTGGACAGTGATGCTGG - Exonic
1032366317 7:131303343-131303365 ACACAGGTGAACACTGAGGCTGG - Intronic
1032613299 7:133439825-133439847 ACACAATTCAACAGTGAGGCAGG - Intronic
1037411235 8:18599968-18599990 GCCCCAGAGAACAGTGATGGTGG - Intronic
1042230353 8:66548233-66548255 ACACCAGTAAACACTGCTCCTGG - Intergenic
1045328203 8:101132953-101132975 ACAACAGTGAACAGTGAGCGAGG + Intergenic
1045769296 8:105716030-105716052 ATACCAGAGAAAAGAGATGCTGG + Intronic
1049891040 9:71688-71710 ACTCCAGTAGACAATGATGCTGG - Intergenic
1050246617 9:3696626-3696648 ACATCAGTGAAGAGTGAGGGTGG - Intergenic
1051361906 9:16288556-16288578 ACCACAGTGAACTGTGATGGTGG - Intergenic
1053113469 9:35481780-35481802 ACACCTGTAAACAGTGAGCCAGG - Intergenic
1053732481 9:41072742-41072764 ACTCCAGTAGACAATGATGCTGG - Intergenic
1054695950 9:68358833-68358855 ACTCCAGTAGACAATGATGCTGG + Intronic
1055354065 9:75419212-75419234 ATAGCAGTGACCAGTGAGGCAGG + Intergenic
1060495902 9:124118436-124118458 CCATCAGTGCACAGTGACGCAGG - Intergenic
1061674955 9:132210459-132210481 TCATCAGTCAACAGTCATGCAGG + Intronic
1061772511 9:132937033-132937055 AAGCCTGTGAACAGTGCTGCAGG + Intronic
1189570390 X:42289413-42289435 TCAAAAGTGAACAGAGATGCAGG - Intergenic
1189582016 X:42416061-42416083 AGACCAGTGGTCAGAGATGCTGG + Intergenic
1190218920 X:48498454-48498476 ACAGCAGTGACCAGTTATGTGGG - Intergenic
1190689243 X:52899704-52899726 ACAGCAGTGAAGCGTGGTGCTGG - Intronic
1190696740 X:52956088-52956110 ACAGCAGTGAAGCGTGGTGCTGG + Intronic
1191204258 X:57817481-57817503 ACACCAGTGGATTGTAATGCTGG + Intergenic
1192892102 X:75401006-75401028 CTACCAGTGAATAGTGAAGCTGG + Intronic
1194366255 X:93018351-93018373 ACACCAGTAAAAACTGAGGCAGG + Intergenic
1197380084 X:125728507-125728529 ACAGAAGTGAAAAGTGATGAAGG + Intergenic
1200674480 Y:6134613-6134635 ACACCAGTAAAAACTGAGGCAGG + Intergenic
1201533417 Y:15017773-15017795 GCACTACTGAACAGTAATGCAGG - Intergenic