ID: 1141743817

View in Genome Browser
Species Human (GRCh38)
Location 16:85912810-85912832
Sequence CTGCGTGTCCAGGGCGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141743811_1141743817 19 Left 1141743811 16:85912768-85912790 CCTTTGGCCAGCATCACTGTTCA 0: 1
1: 0
2: 2
3: 14
4: 165
Right 1141743817 16:85912810-85912832 CTGCGTGTCCAGGGCGTTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 95
1141743813_1141743817 12 Left 1141743813 16:85912775-85912797 CCAGCATCACTGTTCACTGGTGT 0: 1
1: 0
2: 0
3: 6
4: 177
Right 1141743817 16:85912810-85912832 CTGCGTGTCCAGGGCGTTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141743817 Original CRISPR CTGCGTGTCCAGGGCGTTGA GGG Intronic
901205915 1:7495879-7495901 CTGCGAGTCCTGGGAGGTGACGG + Intronic
901800203 1:11704140-11704162 CTCCTTGTCCTGGGGGTTGAGGG - Intronic
912725781 1:112057846-112057868 ATGAGTATCCAGGGCTTTGAAGG - Intergenic
913231131 1:116741585-116741607 CTGCCTGTCCAGTGAGTCGATGG + Intergenic
920176538 1:204105209-204105231 CTGCATGTCAAGGGCGAAGATGG + Intronic
921197868 1:212777507-212777529 CTGCGTGTACACAACGTTGATGG + Intronic
1063148960 10:3320073-3320095 CTGCCTGCCCAGGGCAGTGAGGG - Intergenic
1064379817 10:14831304-14831326 GTGGGAGTCCAGGGGGTTGAAGG - Intronic
1068647364 10:59482418-59482440 CTGCAAGTCCAGAGAGTTGATGG + Intergenic
1070327902 10:75400007-75400029 CTGCCTGTCCTGGGCGTGAATGG + Exonic
1075666562 10:124234748-124234770 CTGCGTGAGCAGGACATTGACGG + Intergenic
1076780726 10:132723157-132723179 CGGCGTCTCCAGGGCGTTGCAGG + Intronic
1076894421 10:133302871-133302893 CTGCGTGTCCACGGAGGAGATGG - Exonic
1078636740 11:13057917-13057939 GTGCATGTCCAGGGAGTTGTGGG + Intergenic
1084322967 11:68383840-68383862 CTGTGTGACCTGGGCCTTGAAGG + Intronic
1084689868 11:70718832-70718854 CTGCCTCTCCAGGGGGATGAAGG - Intronic
1085396575 11:76209757-76209779 CTGCACGCCCAGGGCCTTGAGGG + Intronic
1089309811 11:117550638-117550660 GTGCGTGTCCAGGGAGCTGGCGG - Intronic
1100385558 12:94102033-94102055 CTGGGTGTCCAGGGTGTCCAGGG - Intergenic
1100607584 12:96164263-96164285 CTGAGTGTCCACGCCATTGATGG + Intergenic
1102999533 12:117374952-117374974 CAGCGTGTTCAGGGCCATGATGG + Intronic
1103893939 12:124260953-124260975 CTGCCTGTCCACGGGGATGAGGG + Intronic
1104959063 12:132479618-132479640 CAGCCTGTTCAGGGCATTGAGGG - Intergenic
1106221922 13:27753482-27753504 CTGGGTGTCCAGGGTGTAGATGG - Intergenic
1107276819 13:38687931-38687953 CCGCGCGTCCAGGGCATTGCTGG - Exonic
1124563216 15:30794014-30794036 CTGGGTGTCCTGGGTGTTTACGG - Intergenic
1128728105 15:70002630-70002652 CTGCCTGTCCAGGGAGCTCAGGG + Intergenic
1132869395 16:2109020-2109042 CTCACTGCCCAGGGCGTTGAAGG + Exonic
1134718016 16:16366578-16366600 CTCACTGCCCAGGGCGTTGAAGG - Intergenic
1134956735 16:18385581-18385603 CTCACTGCCCAGGGCGTTGAAGG + Intergenic
1139955437 16:70690869-70690891 CTGGGGGTCCAGGGCATTGAAGG + Intronic
1141743817 16:85912810-85912832 CTGCGTGTCCAGGGCGTTGAGGG + Intronic
1141750862 16:85957029-85957051 CTGCCTGTCCAGGGTGATGTGGG + Intergenic
1141802786 16:86322551-86322573 CTCCCTGGCCAGGGCGTTGGAGG + Intergenic
1142964487 17:3572223-3572245 CTCCGTGTCCAGGATGGTGATGG + Exonic
1142980426 17:3668239-3668261 CTGCGTGCGCAGGGCGGGGAGGG - Intronic
1152641681 17:81451990-81452012 CTGCGTGTCCAGCCGGTCGATGG - Exonic
1152686420 17:81695940-81695962 CTGCGGGTGCATGCCGTTGATGG - Exonic
1157516651 18:48316083-48316105 CCGGGTGTCCAGGTGGTTGATGG - Intronic
1158536324 18:58311442-58311464 CTGGGAGCCCAGGGGGTTGAGGG - Intronic
1159281377 18:66290596-66290618 CTGCGAGTCCTGGGAGTTGGTGG + Intergenic
1160537850 18:79604459-79604481 CTGCGTGCCCAGGGGGCAGAGGG - Intergenic
1162099514 19:8331448-8331470 CTGCGTGTTTAGGGGGTTGGGGG + Intronic
1162143830 19:8600898-8600920 CTGCGTGCCCAGGGAGGGGAAGG + Intronic
1162445115 19:10718169-10718191 CCGCGGGGCCAGGTCGTTGAGGG + Exonic
1164156007 19:22597679-22597701 CTGGGTGTCCTGGGTGTTTATGG - Intergenic
1164598911 19:29548183-29548205 CTCCGTGTCCAGGACGTGGAAGG - Intronic
1166211485 19:41309342-41309364 CTCAGTGGCCAGGGCTTTGATGG - Intronic
1166219342 19:41354653-41354675 CTGGGTGTCCGGGGTGTGGATGG + Exonic
1167246015 19:48373668-48373690 CTGTGTGTCCAGGACGAGGAAGG - Exonic
1167384063 19:49153830-49153852 CTGTGTGTCCTGGGGGGTGATGG + Exonic
926294771 2:11561082-11561104 GTGTGTGTCCAGGGAGTTGCAGG + Intronic
935375108 2:102387683-102387705 CTACATATCCAGGGAGTTGATGG - Intronic
938163589 2:129007893-129007915 ATGAGTGGCCAGGGCATTGAGGG + Intergenic
1171204538 20:23268512-23268534 CTGGGTGTCCAGGGCTGTGCTGG - Intergenic
1171306403 20:24110451-24110473 CTGTGTGTCCAGGGCATTTTGGG - Intergenic
1174822470 20:53738701-53738723 CTGCGTTTCCAGCTCCTTGAAGG + Intergenic
1175077106 20:56385015-56385037 GTGAGTGTCCTGGGGGTTGAGGG - Intronic
1175242736 20:57561686-57561708 CTGCGTCTCCTGGGAGTTGGTGG + Intronic
1175908532 20:62393555-62393577 GTGTGTGACCAGGGCGTTGGTGG + Exonic
1180122268 21:45761752-45761774 GTGAGTGTCCTGGGCCTTGAGGG + Intronic
1180228898 21:46414566-46414588 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228941 21:46414734-46414756 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1182574339 22:31262731-31262753 CTTGGTGTCCAGGGTGCTGAGGG - Exonic
1183073207 22:35410655-35410677 CTGCGTGTCCTGGGCATGGGTGG + Intronic
950369390 3:12515577-12515599 TTGCCTGTCCAGGGCGCTTAGGG - Intronic
950451338 3:13067445-13067467 CTGCTTGTCCTGGGTGCTGAGGG - Intronic
952184833 3:30957342-30957364 CTGCATGTCCAGGGAGGTCAGGG - Intergenic
960995709 3:123338910-123338932 CTGGGTGTCCAGGGTGCTGCAGG - Intronic
967779296 3:193418648-193418670 GTAGGTGTCCAGGGTGTTGATGG - Intronic
968448307 4:663493-663515 CTGAGTGTCCAGGTCCTTGGGGG - Intronic
969440376 4:7213353-7213375 CTTTGTGTCCAGGGCATGGAGGG + Intronic
969556051 4:7911046-7911068 CTGTGTGTCCCGTGCGTTTATGG - Intronic
974824078 4:67104357-67104379 CTTGCTGTGCAGGGCGTTGAAGG + Intergenic
978409533 4:108411893-108411915 ATAGGTGTCCAGGGCGCTGATGG - Intergenic
986830175 5:11568279-11568301 CTGAGAGTCCAGGGAGTTCATGG - Intronic
986900158 5:12421569-12421591 CTATGTGTCCAGGCCTTTGATGG - Intergenic
987750900 5:22037967-22037989 GTACGTGTCCAAGGTGTTGATGG - Intronic
988637038 5:32995783-32995805 CTGCGTGTTGAGGGGGTTGGGGG + Intergenic
988873737 5:35420227-35420249 CTGTGTGTGAAGGGTGTTGAGGG - Intergenic
995047729 5:107670354-107670376 CTGCGTCGCCCGGGCGCTGATGG - Intronic
997643673 5:135466314-135466336 CGGCGGATCCAGGGCGTGGAGGG - Intergenic
1005946907 6:30602086-30602108 CCCCGTGTCCAGGGCCTTCATGG + Exonic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1010135229 6:72543555-72543577 GTAGGTGTCCAGGGTGTTGATGG + Intergenic
1012215094 6:96572735-96572757 GTTGGTGTCCAGGGTGTTGATGG + Intronic
1013026012 6:106272372-106272394 CTGCCTGTTCAGGGCTTTGTAGG - Intronic
1029111524 7:98215097-98215119 CTGCTTGTGCAGGGACTTGAGGG - Exonic
1035309482 7:157956195-157956217 CTGCATGCCCAGGGCTGTGAGGG + Intronic
1037766679 8:21776400-21776422 CTGTGTGTCCTGGGTGTTGCGGG - Intronic
1039444816 8:37622542-37622564 TTGTGTGTTCAGGGCATTGAAGG - Intergenic
1040069357 8:43177712-43177734 CTGTGTTTCAAGGGCTTTGAGGG + Intronic
1045243411 8:100422282-100422304 CTGCGTGTCCTGGATGTTGCCGG + Intergenic
1049539072 8:143198698-143198720 CTGTGTGTTCAGGGAGGTGAAGG - Intergenic
1053560630 9:39190269-39190291 CTGCCTGTCCAGGCCTTCGAGGG - Intronic
1053824731 9:42010513-42010535 CTGCCTGTCCAGGCCTTTGAGGG - Intronic
1054136489 9:61428686-61428708 CTGCCTGTCCAGGCCTTCGAGGG + Intergenic
1054605841 9:67176850-67176872 CTGCCTGTCCAGGCCTTTGAGGG + Intergenic
1057695485 9:97320179-97320201 CTCCTTGTTCAGGGAGTTGAGGG - Exonic
1061323692 9:129849121-129849143 CTTCCTGTCCAGAGGGTTGATGG + Intronic
1186664675 X:11705056-11705078 CTTGGTGTCCAGGGTGCTGAGGG + Intergenic
1191105075 X:56767600-56767622 CTGCCTGCCCAGGGCAGTGAGGG + Intergenic