ID: 1141743818

View in Genome Browser
Species Human (GRCh38)
Location 16:85912817-85912839
Sequence TCCAGGGCGTTGAGGGCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141743813_1141743818 19 Left 1141743813 16:85912775-85912797 CCAGCATCACTGTTCACTGGTGT 0: 1
1: 0
2: 0
3: 6
4: 177
Right 1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG 0: 1
1: 0
2: 0
3: 6
4: 118
1141743811_1141743818 26 Left 1141743811 16:85912768-85912790 CCTTTGGCCAGCATCACTGTTCA 0: 1
1: 0
2: 2
3: 14
4: 165
Right 1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG 0: 1
1: 0
2: 0
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141743818 Original CRISPR TCCAGGGCGTTGAGGGCAAT TGG Intronic
902966918 1:20011879-20011901 TCCAGGGGGTGGTGGGGAATGGG + Intergenic
906151250 1:43588886-43588908 TCCAGGACGTTGCGGCCAACTGG - Exonic
907280733 1:53345638-53345660 TACAGGGTGATGAGGGCCATGGG - Intergenic
912451576 1:109770656-109770678 TCCAGGGCTGTCAGGGCAGTGGG - Intronic
912506232 1:110158420-110158442 TCCAGGGCGTTGTGGGATGTGGG + Intronic
918057708 1:181036413-181036435 TCCTGGGCTTTGAGGGATATTGG + Intronic
920384853 1:205563916-205563938 TCCAGGGTGTTTATGGCAACTGG + Intergenic
1062823077 10:549256-549278 TCCTGGGTGTTGGAGGCAATTGG - Intronic
1063267963 10:4475195-4475217 TCCAGGGCATTCAGGAGAATGGG - Intergenic
1063957131 10:11277414-11277436 TCCAGGGAGGTGAGGGCAGAGGG - Intronic
1067120869 10:43471186-43471208 TGCAAGGGGTTGAGCGCAATGGG - Intronic
1072045442 10:91650132-91650154 TCCAGGGGGTGGGGGGCAAGGGG + Intergenic
1073390905 10:103175763-103175785 TCCAGGGTGCTGAGGCCAAGGGG + Intronic
1076541933 10:131220210-131220232 TCCAGGCTGTTGGGGGCAATAGG - Intronic
1076554423 10:131312177-131312199 TCCAGGGCGCGGAGGGTACTGGG + Intergenic
1076653839 10:132008205-132008227 TCCTTGGAATTGAGGGCAATTGG + Intergenic
1077400285 11:2352257-2352279 TCTAGGGCTTTGAGGGCAGAAGG - Intergenic
1079277769 11:19057650-19057672 TGCAGGGCTTTGAGGGGAAAAGG + Intronic
1082003948 11:47409571-47409593 CCCAGGGCACTGAGGGCAACAGG - Intronic
1083716748 11:64581803-64581825 TCCTGGGCTCTGAGGGCACTAGG + Intergenic
1086879565 11:92137621-92137643 GCCAGGGAGTTCAGGGGAATTGG + Intergenic
1087307253 11:96501663-96501685 TCCAAGGCGGTGATGGCAGTGGG - Intronic
1087618300 11:100514046-100514068 TTCATGGGGTGGAGGGCAATGGG - Intergenic
1088352782 11:108909178-108909200 TCCAGGGAGGTGGGGGGAATAGG - Intronic
1100442158 12:94627246-94627268 GCCAGGGCTTTGGGGGCAACAGG - Intronic
1101269273 12:103126019-103126041 TCCAGGGCAGTGAGTGCAATTGG + Intergenic
1102373066 12:112398788-112398810 GTCAGGGAGTTGAGGGCAAGGGG + Intergenic
1107673499 13:42771058-42771080 TTCAGGGGGTAGAGGGCAAGGGG - Intergenic
1108854056 13:54771868-54771890 GCCAGGGGGTGGAGGGCAAGGGG - Intergenic
1117449944 14:55840260-55840282 TCCATGGCGTGGAAGGCAACAGG - Intergenic
1128341266 15:66824046-66824068 TTCAGGGCCTTGAGGGCCATGGG + Intergenic
1128728108 15:70002637-70002659 TCCAGGGAGCTCAGGGCAAAGGG + Intergenic
1138850880 16:60627909-60627931 GTCAGGGGGTTGAGGGCAAGGGG + Intergenic
1139948980 16:70660175-70660197 TCCAGGGTGCTCAGGGCAAGAGG - Exonic
1139955364 16:70690573-70690595 CCCAGGGCCTTGATGGCACTTGG + Intronic
1139955440 16:70690876-70690898 TCCAGGGCATTGAAGGCTAGGGG + Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1143518660 17:7432930-7432952 TCTAGGGCCTTGAGGATAATGGG - Intergenic
1143872006 17:9963926-9963948 TCTAGGGGGTGGAGGGCAAGGGG + Intronic
1146821441 17:35986143-35986165 TCCATGTCCTTGAGGGCAAGGGG + Intronic
1148542712 17:48493036-48493058 TCCGGGGCGCTGAGGGCTCTGGG - Intergenic
1149278270 17:55070526-55070548 TCAAGGGCATAGAAGGCAATTGG + Intronic
1149353643 17:55817198-55817220 GCCAGGGCTTGGAGGGAAATTGG + Intronic
1150207010 17:63416785-63416807 TCCAGGGTGCTGAGGGAAGTGGG + Intronic
1150854190 17:68734804-68734826 TCAAGGGGGTTGAGGGCAGAGGG - Intergenic
1158880114 18:61769920-61769942 GCCAGGGAGATGAAGGCAATTGG - Intergenic
1160570707 18:79815838-79815860 TCCAGGGCGGTGGGTGCCATCGG - Intergenic
1161274316 19:3407049-3407071 TGCAGGGCCTTGAGCGCCATGGG + Intronic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1163809408 19:19421252-19421274 GCCAGGGAGGTGAGGGCAGTAGG + Intronic
1164802844 19:31092010-31092032 TCCAGGGCTTTGGGGGGACTGGG - Intergenic
1166403294 19:42500432-42500454 GCCAGAGGTTTGAGGGCAATGGG + Intergenic
1167701029 19:51045972-51045994 TCCAGGCTATTGAGGGCAGTGGG - Intergenic
1168267422 19:55230421-55230443 GTCAGGGTGATGAGGGCAATGGG + Exonic
926694727 2:15763305-15763327 ACCAGGGCACTGAGGGAAATAGG + Intergenic
927513288 2:23657935-23657957 TCCAGGCCTCTGAGGCCAATGGG + Intronic
928097305 2:28412526-28412548 TCCAGGGCCGTGAGGGCAAGAGG + Exonic
928165738 2:28970623-28970645 TCCCTGGCGGTGAGGGCCATGGG + Intronic
928272773 2:29871978-29872000 TCTAGGGCTTGGAGGACAATGGG - Intronic
932105318 2:68936495-68936517 TCCAGGGCTTTGAGGGTTACAGG - Intergenic
933652563 2:84861110-84861132 TACAGGGAGGTGAGGCCAATAGG + Intronic
934769213 2:96897194-96897216 TCCAGGGAGTGGGGGGGAATAGG - Intronic
938079145 2:128360048-128360070 TCCAGGGCACTGATGCCAATGGG + Intergenic
938770834 2:134499453-134499475 TCCAGGGCTGTGTGGGCAAATGG - Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
942743552 2:179206672-179206694 TCCAGGGAGTAGGGGGCAAATGG + Intronic
947518170 2:230824790-230824812 TCCAGGACGCTCAGGGCATTTGG - Intergenic
1176085446 20:63293643-63293665 TCCAGGGACTTGGGGGCACTCGG + Intronic
949922064 3:9010603-9010625 TCCAGGGCTAGGAGGGCACTGGG - Intronic
951326842 3:21313185-21313207 ACCAGGGCCTTGAGGGTAAAAGG + Intergenic
954688160 3:52381846-52381868 TCCAGGGCGTGCTGGGCAGTGGG + Intronic
955925742 3:64003041-64003063 TCCAGGGGGTTTGGGGCGATTGG + Exonic
961530553 3:127537492-127537514 TGCAGGGCATTGAGGGCCAGAGG - Intergenic
965361134 3:167739622-167739644 TCCAGGGCCTTGAGGTTAAATGG - Intronic
973456415 4:50570990-50571012 TCCAGCGCTTTCAGGGCTATGGG + Intergenic
973487601 4:51085324-51085346 TCCAGCGCTTTCAGGGCTATGGG + Intergenic
976603627 4:86962077-86962099 GCCAGGGAGTTGAGAGCAAAGGG + Intronic
979104002 4:116661205-116661227 TTCAGGGGGTGGAAGGCAATGGG + Intergenic
984619213 4:181933010-181933032 CCCAGGGGGTTGGGGGCAAGGGG + Intergenic
985879679 5:2628765-2628787 TGCAGGGCGTGGAGTGCAAGGGG - Intergenic
986444677 5:7811077-7811099 TCCAGGTTGTTGGGGGAAATGGG - Intronic
988377464 5:30455777-30455799 GTCAGGGCGTTGGGGGCAAGGGG - Intergenic
995461743 5:112410719-112410741 TCTTGGGCGATAAGGGCAATGGG - Intronic
995736566 5:115307279-115307301 TGCAGGCAGTTGAGGGAAATAGG - Intergenic
997301277 5:132807483-132807505 TCCAGGGACTTGAGGGGGATGGG - Intergenic
998449956 5:142226561-142226583 ACCAGGGCTTTTAGGGCACTTGG + Intergenic
1002849955 6:985193-985215 TGTAGGGGGTTGAGGGCAAGGGG - Intergenic
1005912900 6:30326623-30326645 TCCAGCGCCCTGCGGGCAATGGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006377896 6:33681840-33681862 TCCAGGGCAATGAGGGTGATGGG + Intronic
1006882074 6:37349093-37349115 TGAAGGGGGTTGAGGGAAATGGG + Intergenic
1015854638 6:137610264-137610286 TGCTGGGAGTTGAGGGCAAGGGG + Intergenic
1018967843 6:168502414-168502436 TGCAGGGCATGGAGGGCCATCGG - Intronic
1022792184 7:33700019-33700041 CTCAGGGTGTTGAGTGCAATTGG + Intergenic
1023104405 7:36749422-36749444 TCCAGGGGCTTGGGGGCAAAGGG + Intergenic
1023331251 7:39119252-39119274 TCAACAACGTTGAGGGCAATTGG + Intronic
1025888584 7:65623031-65623053 GTCAGGGGGTTGAGGGCAAAAGG + Intergenic
1030971642 7:116064542-116064564 TCAAGGGGGTGGAGGGCAAGGGG + Intronic
1036125211 8:6056166-6056188 TTCAGGGCCTTGAGGTGAATGGG - Intergenic
1038479249 8:27890516-27890538 TAGATGGCGTGGAGGGCAATGGG + Intronic
1042250761 8:66754000-66754022 TCAGGGGCCTAGAGGGCAATTGG - Intronic
1044468316 8:92534356-92534378 TCCAAGGCTTTGGGGGCAAGTGG + Intergenic
1044553825 8:93540699-93540721 TCCAGGCTTTTGAGGGCAGTTGG - Intergenic
1045912752 8:107429209-107429231 TACAGGGCCTTGAGAGAAATAGG + Intronic
1046706827 8:117463432-117463454 TCCAGGGCCTTGGGGGTATTAGG - Intergenic
1046841138 8:118858520-118858542 TGCAGGGCTTTGTGGGCAATTGG - Intergenic
1048655569 8:136531846-136531868 TCCAGTGTATTGAAGGCAATAGG - Intergenic
1049316707 8:141973032-141973054 GCCAGGGTGTTCTGGGCAATGGG + Intergenic
1054958976 9:70945881-70945903 TGCAGGGTGTTGAGGACATTGGG + Intronic
1057517858 9:95737129-95737151 TCCAGAGCCTCGAGGGCAAGAGG + Intergenic
1059694360 9:116716656-116716678 TCCAGGCAGTTGATTGCAATGGG + Intronic
1059803668 9:117775580-117775602 CCCAGGGGCTTGAGGGCAATGGG + Intergenic
1189742807 X:44138248-44138270 GCCAGGGGGCTGAGGGCAAGAGG + Intergenic
1198037978 X:132820601-132820623 TCCAGGGAGCTGTGGGCAAAAGG + Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201291027 Y:12421044-12421066 TGCAGGGCGTGGAGGGGATTCGG - Intergenic
1202091802 Y:21198689-21198711 GCCAGGGGGTGGAGGGCTATGGG - Intergenic