ID: 1141743818

View in Genome Browser
Species Human (GRCh38)
Location 16:85912817-85912839
Sequence TCCAGGGCGTTGAGGGCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141743811_1141743818 26 Left 1141743811 16:85912768-85912790 CCTTTGGCCAGCATCACTGTTCA 0: 1
1: 0
2: 2
3: 14
4: 165
Right 1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG 0: 1
1: 0
2: 0
3: 6
4: 118
1141743813_1141743818 19 Left 1141743813 16:85912775-85912797 CCAGCATCACTGTTCACTGGTGT 0: 1
1: 0
2: 0
3: 6
4: 177
Right 1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG 0: 1
1: 0
2: 0
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141743818 Original CRISPR TCCAGGGCGTTGAGGGCAAT TGG Intronic