ID: 1141749030

View in Genome Browser
Species Human (GRCh38)
Location 16:85946014-85946036
Sequence GTGCATAAGGATGGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141749018_1141749030 6 Left 1141749018 16:85945985-85946007 CCAGCTGGCACTGGGCAGGTGGG No data
Right 1141749030 16:85946014-85946036 GTGCATAAGGATGGGGAGGATGG No data
1141749012_1141749030 29 Left 1141749012 16:85945962-85945984 CCAGGTGAGAACAGGCAGGGTAT No data
Right 1141749030 16:85946014-85946036 GTGCATAAGGATGGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141749030 Original CRISPR GTGCATAAGGATGGGGAGGA TGG Intergenic
No off target data available for this crispr