ID: 1141749241

View in Genome Browser
Species Human (GRCh38)
Location 16:85947113-85947135
Sequence CCTGCCAGGTTCCCCAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141749241_1141749246 -3 Left 1141749241 16:85947113-85947135 CCAGGCTTGGGGAACCTGGCAGG No data
Right 1141749246 16:85947133-85947155 AGGGCTGCAGATGGATCACCAGG No data
1141749241_1141749249 19 Left 1141749241 16:85947113-85947135 CCAGGCTTGGGGAACCTGGCAGG No data
Right 1141749249 16:85947155-85947177 GCTAATGAAGCTGGAACTCCAGG No data
1141749241_1141749247 10 Left 1141749241 16:85947113-85947135 CCAGGCTTGGGGAACCTGGCAGG No data
Right 1141749247 16:85947146-85947168 GATCACCAGGCTAATGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141749241 Original CRISPR CCTGCCAGGTTCCCCAAGCC TGG (reversed) Intergenic
No off target data available for this crispr