ID: 1141754645

View in Genome Browser
Species Human (GRCh38)
Location 16:85983179-85983201
Sequence TGCCTGAGGCCACACAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141754641_1141754645 23 Left 1141754641 16:85983133-85983155 CCCTATCGTACAGAGTCTGAGAT No data
Right 1141754645 16:85983179-85983201 TGCCTGAGGCCACACAGTGATGG No data
1141754642_1141754645 22 Left 1141754642 16:85983134-85983156 CCTATCGTACAGAGTCTGAGATG No data
Right 1141754645 16:85983179-85983201 TGCCTGAGGCCACACAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141754645 Original CRISPR TGCCTGAGGCCACACAGTGA TGG Intergenic
No off target data available for this crispr