ID: 1141757229

View in Genome Browser
Species Human (GRCh38)
Location 16:85999314-85999336
Sequence CAGTGAGGGGCTTGAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141757229_1141757234 -9 Left 1141757229 16:85999314-85999336 CCCTCTGCTCAAGCCCCTCACTG No data
Right 1141757234 16:85999328-85999350 CCCTCACTGCTGTCAGGATGAGG No data
1141757229_1141757238 23 Left 1141757229 16:85999314-85999336 CCCTCTGCTCAAGCCCCTCACTG No data
Right 1141757238 16:85999360-85999382 TTAGCAGTGCTGTCAGGATGAGG No data
1141757229_1141757236 17 Left 1141757229 16:85999314-85999336 CCCTCTGCTCAAGCCCCTCACTG No data
Right 1141757236 16:85999354-85999376 GAGTCCTTAGCAGTGCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141757229 Original CRISPR CAGTGAGGGGCTTGAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr