ID: 1141757670

View in Genome Browser
Species Human (GRCh38)
Location 16:86003121-86003143
Sequence AGACCCGTGATTGCCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141757670_1141757674 29 Left 1141757670 16:86003121-86003143 CCAGCCCCGGCAATCACGGGTCT No data
Right 1141757674 16:86003173-86003195 TTTCTAGAATTCTATAAAAATGG 0: 2
1: 9
2: 105
3: 384
4: 1411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141757670 Original CRISPR AGACCCGTGATTGCCGGGGC TGG (reversed) Intergenic
No off target data available for this crispr