ID: 1141761911

View in Genome Browser
Species Human (GRCh38)
Location 16:86034133-86034155
Sequence TGCCATTGCCAGGCTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141761904_1141761911 -7 Left 1141761904 16:86034117-86034139 CCTTGAGTCCAAGCCCTGCCATT No data
Right 1141761911 16:86034133-86034155 TGCCATTGCCAGGCTGGGCAAGG No data
1141761903_1141761911 -3 Left 1141761903 16:86034113-86034135 CCAGCCTTGAGTCCAAGCCCTGC No data
Right 1141761911 16:86034133-86034155 TGCCATTGCCAGGCTGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141761911 Original CRISPR TGCCATTGCCAGGCTGGGCA AGG Intergenic
No off target data available for this crispr