ID: 1141762172

View in Genome Browser
Species Human (GRCh38)
Location 16:86035836-86035858
Sequence CACTCCCTCCAGAGGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141762172_1141762180 11 Left 1141762172 16:86035836-86035858 CCCTAGAGCCTCTGGAGGGAGTG No data
Right 1141762180 16:86035870-86035892 ACACCTTGATTGCAGACTTCTGG 0: 4
1: 153
2: 361
3: 775
4: 1257
1141762172_1141762184 25 Left 1141762172 16:86035836-86035858 CCCTAGAGCCTCTGGAGGGAGTG No data
Right 1141762184 16:86035884-86035906 GACTTCTGGCCTCCGGAGCTGGG No data
1141762172_1141762182 18 Left 1141762172 16:86035836-86035858 CCCTAGAGCCTCTGGAGGGAGTG No data
Right 1141762182 16:86035877-86035899 GATTGCAGACTTCTGGCCTCCGG No data
1141762172_1141762183 24 Left 1141762172 16:86035836-86035858 CCCTAGAGCCTCTGGAGGGAGTG No data
Right 1141762183 16:86035883-86035905 AGACTTCTGGCCTCCGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141762172 Original CRISPR CACTCCCTCCAGAGGCTCTA GGG (reversed) Intergenic
No off target data available for this crispr