ID: 1141763351

View in Genome Browser
Species Human (GRCh38)
Location 16:86043390-86043412
Sequence CTGCCCGCTGTGCGGTGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141763339_1141763351 29 Left 1141763339 16:86043338-86043360 CCTGCTGCCGTTCATCTTGGGGT No data
Right 1141763351 16:86043390-86043412 CTGCCCGCTGTGCGGTGAATGGG No data
1141763340_1141763351 22 Left 1141763340 16:86043345-86043367 CCGTTCATCTTGGGGTCTCCATA No data
Right 1141763351 16:86043390-86043412 CTGCCCGCTGTGCGGTGAATGGG No data
1141763341_1141763351 4 Left 1141763341 16:86043363-86043385 CCATATCCCTTACCTGTCCCCTT No data
Right 1141763351 16:86043390-86043412 CTGCCCGCTGTGCGGTGAATGGG No data
1141763344_1141763351 -3 Left 1141763344 16:86043370-86043392 CCTTACCTGTCCCCTTGGCTCTG No data
Right 1141763351 16:86043390-86043412 CTGCCCGCTGTGCGGTGAATGGG No data
1141763345_1141763351 -8 Left 1141763345 16:86043375-86043397 CCTGTCCCCTTGGCTCTGCCCGC No data
Right 1141763351 16:86043390-86043412 CTGCCCGCTGTGCGGTGAATGGG No data
1141763343_1141763351 -2 Left 1141763343 16:86043369-86043391 CCCTTACCTGTCCCCTTGGCTCT No data
Right 1141763351 16:86043390-86043412 CTGCCCGCTGTGCGGTGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141763351 Original CRISPR CTGCCCGCTGTGCGGTGAAT GGG Intergenic
No off target data available for this crispr