ID: 1141764939

View in Genome Browser
Species Human (GRCh38)
Location 16:86052020-86052042
Sequence TGCTTGTGTTGAGGGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141764933_1141764939 14 Left 1141764933 16:86051983-86052005 CCGTGGCAGCGTTTTGTCAAATC No data
Right 1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG No data
1141764932_1141764939 18 Left 1141764932 16:86051979-86052001 CCGGCCGTGGCAGCGTTTTGTCA No data
Right 1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG No data
1141764929_1141764939 27 Left 1141764929 16:86051970-86051992 CCCTGACACCCGGCCGTGGCAGC No data
Right 1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG No data
1141764930_1141764939 26 Left 1141764930 16:86051971-86051993 CCTGACACCCGGCCGTGGCAGCG No data
Right 1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG No data
1141764928_1141764939 28 Left 1141764928 16:86051969-86051991 CCCCTGACACCCGGCCGTGGCAG No data
Right 1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG No data
1141764931_1141764939 19 Left 1141764931 16:86051978-86052000 CCCGGCCGTGGCAGCGTTTTGTC No data
Right 1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141764939 Original CRISPR TGCTTGTGTTGAGGGTGTGC AGG Intergenic
No off target data available for this crispr