ID: 1141766419

View in Genome Browser
Species Human (GRCh38)
Location 16:86062674-86062696
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141766409_1141766419 6 Left 1141766409 16:86062645-86062667 CCAAGCAAGCAGTGGTTTCTTGG No data
Right 1141766419 16:86062674-86062696 TGCCGCAGGCTGACCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141766419 Original CRISPR TGCCGCAGGCTGACCAGGCA GGG Intergenic
No off target data available for this crispr