ID: 1141767946

View in Genome Browser
Species Human (GRCh38)
Location 16:86071079-86071101
Sequence CTTGACCGGGCACTGTGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141767946_1141767950 16 Left 1141767946 16:86071079-86071101 CCAAAGCACAGTGCCCGGTCAAG No data
Right 1141767950 16:86071118-86071140 CAAAAGCACCCAGCCATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141767946 Original CRISPR CTTGACCGGGCACTGTGCTT TGG (reversed) Intergenic
No off target data available for this crispr