ID: 1141768650

View in Genome Browser
Species Human (GRCh38)
Location 16:86075115-86075137
Sequence CGGCTGGGTGATCCGTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141768640_1141768650 1 Left 1141768640 16:86075091-86075113 CCTTTGGGACTCCTCTGAGGCCC No data
Right 1141768650 16:86075115-86075137 CGGCTGGGTGATCCGTCTGGTGG No data
1141768644_1141768650 -10 Left 1141768644 16:86075102-86075124 CCTCTGAGGCCCCCGGCTGGGTG No data
Right 1141768650 16:86075115-86075137 CGGCTGGGTGATCCGTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141768650 Original CRISPR CGGCTGGGTGATCCGTCTGG TGG Intergenic
No off target data available for this crispr