ID: 1141769579

View in Genome Browser
Species Human (GRCh38)
Location 16:86081507-86081529
Sequence CAGCCGTGCTGTGTGACCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141769579_1141769584 -4 Left 1141769579 16:86081507-86081529 CCCGTGGTCACACAGCACGGCTG 0: 1
1: 0
2: 4
3: 18
4: 244
Right 1141769584 16:86081526-86081548 GCTGGCTTCTGCAGGGTTTCAGG 0: 1
1: 0
2: 4
3: 73
4: 636

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141769579 Original CRISPR CAGCCGTGCTGTGTGACCAC GGG (reversed) Intergenic