ID: 1141771205

View in Genome Browser
Species Human (GRCh38)
Location 16:86090647-86090669
Sequence TGCCCTTTAACCCCAAGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141771205_1141771211 8 Left 1141771205 16:86090647-86090669 CCGGGTCTTGGGGTTAAAGGGCA No data
Right 1141771211 16:86090678-86090700 CATCTACCGGGGGCTCCATGTGG No data
1141771205_1141771209 -3 Left 1141771205 16:86090647-86090669 CCGGGTCTTGGGGTTAAAGGGCA No data
Right 1141771209 16:86090667-86090689 GCAAAGGTCAGCATCTACCGGGG No data
1141771205_1141771208 -4 Left 1141771205 16:86090647-86090669 CCGGGTCTTGGGGTTAAAGGGCA No data
Right 1141771208 16:86090666-86090688 GGCAAAGGTCAGCATCTACCGGG No data
1141771205_1141771207 -5 Left 1141771205 16:86090647-86090669 CCGGGTCTTGGGGTTAAAGGGCA No data
Right 1141771207 16:86090665-86090687 GGGCAAAGGTCAGCATCTACCGG No data
1141771205_1141771213 13 Left 1141771205 16:86090647-86090669 CCGGGTCTTGGGGTTAAAGGGCA No data
Right 1141771213 16:86090683-86090705 ACCGGGGGCTCCATGTGGGATGG No data
1141771205_1141771210 -2 Left 1141771205 16:86090647-86090669 CCGGGTCTTGGGGTTAAAGGGCA No data
Right 1141771210 16:86090668-86090690 CAAAGGTCAGCATCTACCGGGGG No data
1141771205_1141771212 9 Left 1141771205 16:86090647-86090669 CCGGGTCTTGGGGTTAAAGGGCA No data
Right 1141771212 16:86090679-86090701 ATCTACCGGGGGCTCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141771205 Original CRISPR TGCCCTTTAACCCCAAGACC CGG (reversed) Intergenic
No off target data available for this crispr