ID: 1141771212

View in Genome Browser
Species Human (GRCh38)
Location 16:86090679-86090701
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141771205_1141771212 9 Left 1141771205 16:86090647-86090669 CCGGGTCTTGGGGTTAAAGGGCA No data
Right 1141771212 16:86090679-86090701 ATCTACCGGGGGCTCCATGTGGG No data
1141771202_1141771212 18 Left 1141771202 16:86090638-86090660 CCAGGGCAGCCGGGTCTTGGGGT No data
Right 1141771212 16:86090679-86090701 ATCTACCGGGGGCTCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141771212 Original CRISPR ATCTACCGGGGGCTCCATGT GGG Intergenic
No off target data available for this crispr