ID: 1141772278

View in Genome Browser
Species Human (GRCh38)
Location 16:86096605-86096627
Sequence GTTGTACAGGACTCTAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141772278_1141772286 4 Left 1141772278 16:86096605-86096627 CCCAAATTAGAGTCCTGTACAAC No data
Right 1141772286 16:86096632-86096654 TCCCATGAAAGTATTTGTGGGGG No data
1141772278_1141772284 2 Left 1141772278 16:86096605-86096627 CCCAAATTAGAGTCCTGTACAAC No data
Right 1141772284 16:86096630-86096652 AGTCCCATGAAAGTATTTGTGGG No data
1141772278_1141772285 3 Left 1141772278 16:86096605-86096627 CCCAAATTAGAGTCCTGTACAAC No data
Right 1141772285 16:86096631-86096653 GTCCCATGAAAGTATTTGTGGGG No data
1141772278_1141772283 1 Left 1141772278 16:86096605-86096627 CCCAAATTAGAGTCCTGTACAAC No data
Right 1141772283 16:86096629-86096651 CAGTCCCATGAAAGTATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141772278 Original CRISPR GTTGTACAGGACTCTAATTT GGG (reversed) Intergenic