ID: 1141774773

View in Genome Browser
Species Human (GRCh38)
Location 16:86115974-86115996
Sequence CCTGCAAAGCAGAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141774773_1141774782 4 Left 1141774773 16:86115974-86115996 CCATCCTCCCTCTGCTTTGCAGG No data
Right 1141774782 16:86116001-86116023 CCCCTCCCCACCCTGGCCTCAGG No data
1141774773_1141774778 -3 Left 1141774773 16:86115974-86115996 CCATCCTCCCTCTGCTTTGCAGG No data
Right 1141774778 16:86115994-86116016 AGGCCACCCCCTCCCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141774773 Original CRISPR CCTGCAAAGCAGAGGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr