ID: 1141774782

View in Genome Browser
Species Human (GRCh38)
Location 16:86116001-86116023
Sequence CCCCTCCCCACCCTGGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141774773_1141774782 4 Left 1141774773 16:86115974-86115996 CCATCCTCCCTCTGCTTTGCAGG No data
Right 1141774782 16:86116001-86116023 CCCCTCCCCACCCTGGCCTCAGG No data
1141774776_1141774782 -3 Left 1141774776 16:86115981-86116003 CCCTCTGCTTTGCAGGCCACCCC No data
Right 1141774782 16:86116001-86116023 CCCCTCCCCACCCTGGCCTCAGG No data
1141774771_1141774782 26 Left 1141774771 16:86115952-86115974 CCAAGGGGGACCTGGGGCATCTC No data
Right 1141774782 16:86116001-86116023 CCCCTCCCCACCCTGGCCTCAGG No data
1141774775_1141774782 0 Left 1141774775 16:86115978-86116000 CCTCCCTCTGCTTTGCAGGCCAC No data
Right 1141774782 16:86116001-86116023 CCCCTCCCCACCCTGGCCTCAGG No data
1141774777_1141774782 -4 Left 1141774777 16:86115982-86116004 CCTCTGCTTTGCAGGCCACCCCC No data
Right 1141774782 16:86116001-86116023 CCCCTCCCCACCCTGGCCTCAGG No data
1141774770_1141774782 27 Left 1141774770 16:86115951-86115973 CCCAAGGGGGACCTGGGGCATCT No data
Right 1141774782 16:86116001-86116023 CCCCTCCCCACCCTGGCCTCAGG No data
1141774772_1141774782 16 Left 1141774772 16:86115962-86115984 CCTGGGGCATCTCCATCCTCCCT No data
Right 1141774782 16:86116001-86116023 CCCCTCCCCACCCTGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141774782 Original CRISPR CCCCTCCCCACCCTGGCCTC AGG Intergenic
No off target data available for this crispr