ID: 1141776214

View in Genome Browser
Species Human (GRCh38)
Location 16:86124137-86124159
Sequence CGGGTGCATGCCACCACGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121228
Summary {0: 12, 1: 900, 2: 9194, 3: 32279, 4: 78843}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141776214_1141776215 -6 Left 1141776214 16:86124137-86124159 CCAGGCGTGGTGGCATGCACCCG 0: 12
1: 900
2: 9194
3: 32279
4: 78843
Right 1141776215 16:86124154-86124176 CACCCGTAGTCCCAGCTACTTGG 0: 261
1: 28411
2: 102183
3: 130147
4: 150131
1141776214_1141776221 4 Left 1141776214 16:86124137-86124159 CCAGGCGTGGTGGCATGCACCCG 0: 12
1: 900
2: 9194
3: 32279
4: 78843
Right 1141776221 16:86124164-86124186 CCCAGCTACTTGGGAGGCTGAGG 0: 89011
1: 200457
2: 243521
3: 257984
4: 301655
1141776214_1141776225 30 Left 1141776214 16:86124137-86124159 CCAGGCGTGGTGGCATGCACCCG 0: 12
1: 900
2: 9194
3: 32279
4: 78843
Right 1141776225 16:86124190-86124212 AAGAATTACTTGAAGTCGGGAGG No data
1141776214_1141776216 -5 Left 1141776214 16:86124137-86124159 CCAGGCGTGGTGGCATGCACCCG 0: 12
1: 900
2: 9194
3: 32279
4: 78843
Right 1141776216 16:86124155-86124177 ACCCGTAGTCCCAGCTACTTGGG 0: 135
1: 14607
2: 96864
3: 239586
4: 260947
1141776214_1141776223 26 Left 1141776214 16:86124137-86124159 CCAGGCGTGGTGGCATGCACCCG 0: 12
1: 900
2: 9194
3: 32279
4: 78843
Right 1141776223 16:86124186-86124208 GCAGAAGAATTACTTGAAGTCGG No data
1141776214_1141776224 27 Left 1141776214 16:86124137-86124159 CCAGGCGTGGTGGCATGCACCCG 0: 12
1: 900
2: 9194
3: 32279
4: 78843
Right 1141776224 16:86124187-86124209 CAGAAGAATTACTTGAAGTCGGG No data
1141776214_1141776219 -2 Left 1141776214 16:86124137-86124159 CCAGGCGTGGTGGCATGCACCCG 0: 12
1: 900
2: 9194
3: 32279
4: 78843
Right 1141776219 16:86124158-86124180 CGTAGTCCCAGCTACTTGGGAGG 0: 429
1: 44056
2: 158929
3: 224271
4: 229535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141776214 Original CRISPR CGGGTGCATGCCACCACGCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr