ID: 1141776217

View in Genome Browser
Species Human (GRCh38)
Location 16:86124156-86124178
Sequence TCCCAAGTAGCTGGGACTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1094658
Summary {0: 41425, 1: 153414, 2: 219429, 3: 225665, 4: 454725}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141776217_1141776226 17 Left 1141776217 16:86124156-86124178 CCCGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 1141776226 16:86124196-86124218 TACTTGAAGTCGGGAGGCAGAGG No data
1141776217_1141776225 11 Left 1141776217 16:86124156-86124178 CCCGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 1141776225 16:86124190-86124212 AAGAATTACTTGAAGTCGGGAGG No data
1141776217_1141776223 7 Left 1141776217 16:86124156-86124178 CCCGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 1141776223 16:86124186-86124208 GCAGAAGAATTACTTGAAGTCGG No data
1141776217_1141776224 8 Left 1141776217 16:86124156-86124178 CCCGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 1141776224 16:86124187-86124209 CAGAAGAATTACTTGAAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141776217 Original CRISPR TCCCAAGTAGCTGGGACTAC GGG (reversed) Intergenic
Too many off-targets to display for this crispr