ID: 1141776218

View in Genome Browser
Species Human (GRCh38)
Location 16:86124157-86124179
Sequence CTCCCAAGTAGCTGGGACTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21427
Summary {0: 704, 1: 2707, 2: 4353, 3: 5033, 4: 8630}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141776218_1141776226 16 Left 1141776218 16:86124157-86124179 CCGTAGTCCCAGCTACTTGGGAG 0: 704
1: 2707
2: 4353
3: 5033
4: 8630
Right 1141776226 16:86124196-86124218 TACTTGAAGTCGGGAGGCAGAGG No data
1141776218_1141776224 7 Left 1141776218 16:86124157-86124179 CCGTAGTCCCAGCTACTTGGGAG 0: 704
1: 2707
2: 4353
3: 5033
4: 8630
Right 1141776224 16:86124187-86124209 CAGAAGAATTACTTGAAGTCGGG No data
1141776218_1141776223 6 Left 1141776218 16:86124157-86124179 CCGTAGTCCCAGCTACTTGGGAG 0: 704
1: 2707
2: 4353
3: 5033
4: 8630
Right 1141776223 16:86124186-86124208 GCAGAAGAATTACTTGAAGTCGG No data
1141776218_1141776225 10 Left 1141776218 16:86124157-86124179 CCGTAGTCCCAGCTACTTGGGAG 0: 704
1: 2707
2: 4353
3: 5033
4: 8630
Right 1141776225 16:86124190-86124212 AAGAATTACTTGAAGTCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141776218 Original CRISPR CTCCCAAGTAGCTGGGACTA CGG (reversed) Intergenic
Too many off-targets to display for this crispr