ID: 1141776220 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:86124164-86124186 |
| Sequence | CCTCAGCCTCCCAAGTAGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 1107888 | |||
| Summary | {0: 92836, 1: 203589, 2: 246027, 3: 262461, 4: 302975} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1141776220_1141776224 | 0 | Left | 1141776220 | 16:86124164-86124186 | CCCAGCTACTTGGGAGGCTGAGG | 0: 92836 1: 203589 2: 246027 3: 262461 4: 302975 |
||
| Right | 1141776224 | 16:86124187-86124209 | CAGAAGAATTACTTGAAGTCGGG | No data | ||||
| 1141776220_1141776226 | 9 | Left | 1141776220 | 16:86124164-86124186 | CCCAGCTACTTGGGAGGCTGAGG | 0: 92836 1: 203589 2: 246027 3: 262461 4: 302975 |
||
| Right | 1141776226 | 16:86124196-86124218 | TACTTGAAGTCGGGAGGCAGAGG | No data | ||||
| 1141776220_1141776225 | 3 | Left | 1141776220 | 16:86124164-86124186 | CCCAGCTACTTGGGAGGCTGAGG | 0: 92836 1: 203589 2: 246027 3: 262461 4: 302975 |
||
| Right | 1141776225 | 16:86124190-86124212 | AAGAATTACTTGAAGTCGGGAGG | No data | ||||
| 1141776220_1141776223 | -1 | Left | 1141776220 | 16:86124164-86124186 | CCCAGCTACTTGGGAGGCTGAGG | 0: 92836 1: 203589 2: 246027 3: 262461 4: 302975 |
||
| Right | 1141776223 | 16:86124186-86124208 | GCAGAAGAATTACTTGAAGTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1141776220 | Original CRISPR | CCTCAGCCTCCCAAGTAGCT GGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||