ID: 1141776220

View in Genome Browser
Species Human (GRCh38)
Location 16:86124164-86124186
Sequence CCTCAGCCTCCCAAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1107888
Summary {0: 92836, 1: 203589, 2: 246027, 3: 262461, 4: 302975}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141776220_1141776224 0 Left 1141776220 16:86124164-86124186 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1141776224 16:86124187-86124209 CAGAAGAATTACTTGAAGTCGGG No data
1141776220_1141776226 9 Left 1141776220 16:86124164-86124186 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1141776226 16:86124196-86124218 TACTTGAAGTCGGGAGGCAGAGG No data
1141776220_1141776225 3 Left 1141776220 16:86124164-86124186 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1141776225 16:86124190-86124212 AAGAATTACTTGAAGTCGGGAGG No data
1141776220_1141776223 -1 Left 1141776220 16:86124164-86124186 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1141776223 16:86124186-86124208 GCAGAAGAATTACTTGAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141776220 Original CRISPR CCTCAGCCTCCCAAGTAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr