ID: 1141776222

View in Genome Browser
Species Human (GRCh38)
Location 16:86124165-86124187
Sequence GCCTCAGCCTCCCAAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1008369
Summary {0: 81212, 1: 190903, 2: 234468, 3: 228974, 4: 272812}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141776222_1141776223 -2 Left 1141776222 16:86124165-86124187 CCAGCTACTTGGGAGGCTGAGGC 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
Right 1141776223 16:86124186-86124208 GCAGAAGAATTACTTGAAGTCGG No data
1141776222_1141776226 8 Left 1141776222 16:86124165-86124187 CCAGCTACTTGGGAGGCTGAGGC 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
Right 1141776226 16:86124196-86124218 TACTTGAAGTCGGGAGGCAGAGG No data
1141776222_1141776224 -1 Left 1141776222 16:86124165-86124187 CCAGCTACTTGGGAGGCTGAGGC 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
Right 1141776224 16:86124187-86124209 CAGAAGAATTACTTGAAGTCGGG No data
1141776222_1141776225 2 Left 1141776222 16:86124165-86124187 CCAGCTACTTGGGAGGCTGAGGC 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
Right 1141776225 16:86124190-86124212 AAGAATTACTTGAAGTCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141776222 Original CRISPR GCCTCAGCCTCCCAAGTAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr