ID: 1141776224

View in Genome Browser
Species Human (GRCh38)
Location 16:86124187-86124209
Sequence CAGAAGAATTACTTGAAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141776218_1141776224 7 Left 1141776218 16:86124157-86124179 CCGTAGTCCCAGCTACTTGGGAG 0: 704
1: 2707
2: 4353
3: 5033
4: 8630
Right 1141776224 16:86124187-86124209 CAGAAGAATTACTTGAAGTCGGG No data
1141776214_1141776224 27 Left 1141776214 16:86124137-86124159 CCAGGCGTGGTGGCATGCACCCG 0: 12
1: 900
2: 9194
3: 32279
4: 78843
Right 1141776224 16:86124187-86124209 CAGAAGAATTACTTGAAGTCGGG No data
1141776222_1141776224 -1 Left 1141776222 16:86124165-86124187 CCAGCTACTTGGGAGGCTGAGGC 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
Right 1141776224 16:86124187-86124209 CAGAAGAATTACTTGAAGTCGGG No data
1141776220_1141776224 0 Left 1141776220 16:86124164-86124186 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1141776224 16:86124187-86124209 CAGAAGAATTACTTGAAGTCGGG No data
1141776217_1141776224 8 Left 1141776217 16:86124156-86124178 CCCGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 1141776224 16:86124187-86124209 CAGAAGAATTACTTGAAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141776224 Original CRISPR CAGAAGAATTACTTGAAGTC GGG Intergenic
No off target data available for this crispr