ID: 1141780679

View in Genome Browser
Species Human (GRCh38)
Location 16:86158439-86158461
Sequence CTGGGGACACAGCATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 1, 2: 4, 3: 56, 4: 533}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141780674_1141780679 4 Left 1141780674 16:86158412-86158434 CCTGTCTGCGGAGGACTGAGCTA 0: 1
1: 0
2: 0
3: 2
4: 76
Right 1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG 0: 1
1: 1
2: 4
3: 56
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141780679 Original CRISPR CTGGGGACACAGCATGAGGA TGG Intergenic
900226018 1:1534058-1534080 CTGTGGACTCAGGATGGGGAGGG - Exonic
900422407 1:2561254-2561276 CTGGGGCCAGAGGACGAGGAGGG - Intronic
900433444 1:2613660-2613682 TTGGAGTCAAAGCATGAGGAGGG + Intronic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901465759 1:9419990-9420012 CTGAGGACTCAGCCTGAGGTAGG + Intergenic
902374295 1:16023037-16023059 CTGGGGGCACAGCAAGGGGCTGG + Intronic
902379248 1:16044914-16044936 CTGGGGCCACAGCAAGGGGCTGG + Intronic
902392986 1:16116905-16116927 CTGGGGAGACAGCAAGGGGTGGG - Intergenic
903325563 1:22566877-22566899 ATGGGGACAGAGGAAGAGGAGGG + Intronic
903553159 1:24172862-24172884 GTGAGGACACAGCAAGATGACGG - Intronic
903666657 1:25012106-25012128 CTGGGGACAGAGAATGATCAAGG - Intergenic
904371936 1:30053464-30053486 GTGGGGAGACCGCCTGAGGATGG + Intergenic
906402008 1:45511406-45511428 CTGGGCACACTGCAAGAGAAAGG + Exonic
906532928 1:46533653-46533675 GTGGGCACACAGCAAGAGGGCGG + Intergenic
906811802 1:48834591-48834613 CTGAGGACACAGCAAGAAGGAGG + Intronic
907392583 1:54167981-54168003 CTGGGGATGCAGCAAGAGGGAGG + Intronic
907433559 1:54429422-54429444 CTCGGGAAGCTGCATGAGGAGGG + Intergenic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
907977321 1:59444589-59444611 CTGGCTGCACAGCATGAGGTGGG + Intronic
909039111 1:70628861-70628883 CTGGGTTCACACCATGAAGAAGG + Intergenic
910529998 1:88225134-88225156 TTGGGAGCACAGCAAGAGGAAGG - Intergenic
910632392 1:89369469-89369491 CTGGGGCCACAGCATCAGACTGG - Intronic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
913181698 1:116328774-116328796 ATGGGGACAAAGGAAGAGGAAGG + Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915748943 1:158186665-158186687 GGAGGGACACAGCAGGAGGAAGG + Intergenic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916060740 1:161097084-161097106 CAGAGAACACAGCATGGGGATGG - Intergenic
916941307 1:169681357-169681379 CTGGGGATCCAGCATCTGGAAGG - Intronic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
918145668 1:181753628-181753650 CGGAGGACACAGCTTGGGGAGGG + Intronic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
919046350 1:192457519-192457541 CTGAGGACACAGCAAGAAGGTGG - Intergenic
919676778 1:200391740-200391762 TTGGGGAAACAAAATGAGGAAGG + Intergenic
919680300 1:200427852-200427874 CTGGTGACACAACATAAAGAAGG + Intergenic
919696835 1:200585697-200585719 GTGAGGACATAGCATGAAGATGG - Intronic
919920056 1:202162133-202162155 CTGGGGACACAGGAGGGGGCAGG + Intergenic
920308543 1:205034287-205034309 CAGGGCACACAGCATGGAGAGGG - Intergenic
920590742 1:207216264-207216286 GTGGGGACAGATCTTGAGGAGGG + Intergenic
920771069 1:208886133-208886155 CTGGGGACTGAGCAATAGGAAGG + Intergenic
920824777 1:209415095-209415117 CTGGTGACACAGCATGTGACAGG - Intergenic
921558912 1:216633273-216633295 CGGAGGAGACAGCATGAGCAAGG + Intronic
923627219 1:235623771-235623793 CTGGGGAGACAGCATGATGAGGG - Intronic
923655261 1:235910424-235910446 CAGGGGCCACAGAATGTGGATGG - Intergenic
924798344 1:247309191-247309213 CTGGCGACACAGCCTGAAGGAGG + Intronic
924808174 1:247378358-247378380 GTGAGGACACAGCAAGAGGGTGG + Intergenic
1063366113 10:5491927-5491949 CTGGGTACACTGCCTGTGGAAGG - Intergenic
1063716597 10:8533531-8533553 CTGAGGCCACAGTACGAGGAGGG + Intergenic
1063856016 10:10254943-10254965 CTGGGGACCCAGCTTTAGGGAGG + Intergenic
1064277742 10:13922070-13922092 CTGAGGACACAGCAAGAAGGTGG + Intronic
1064578864 10:16773293-16773315 TTAGGGTCACTGCATGAGGAGGG + Intronic
1064856458 10:19773746-19773768 ATGAGGACACAGCAAGAAGAAGG - Intronic
1066214277 10:33270759-33270781 CTGAAGACACAACAGGAGGAGGG + Exonic
1066269981 10:33812952-33812974 CTGGGGACACTGCTTGTGGCTGG - Intergenic
1066340371 10:34526696-34526718 CTGGTGGCACAGCAGGAGGAGGG - Intronic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067011428 10:42717534-42717556 TTAGGGTCACTGCATGAGGAAGG - Intergenic
1067064308 10:43095096-43095118 CTGGGGTCAGAGCCTGAGGGAGG + Intronic
1067170845 10:43904607-43904629 CTGGGGAAACAGCTTGCAGAGGG - Intergenic
1067237074 10:44460086-44460108 CTGGGGAGAGAGCATGAGGCTGG - Intergenic
1067312154 10:45124294-45124316 TTAGGGTCACTGCATGAGGAGGG + Intergenic
1067474493 10:46556812-46556834 GTGGGGACCCGGCCTGAGGAGGG - Intergenic
1067828689 10:49597624-49597646 CTGAGGACCCTGCAGGAGGATGG - Intergenic
1068588755 10:58831984-58832006 CTGGGGGCATAGTATGTGGAGGG - Intergenic
1069807558 10:71135532-71135554 GGGAGGACACAGCATGAAGATGG - Intergenic
1069818057 10:71211162-71211184 CTGGGCACCCAGCATCAGGAGGG - Intergenic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1071844079 10:89503798-89503820 CTGGGGCCACAGCAACAGGAAGG + Intronic
1071873073 10:89816172-89816194 GTGAGGACACAGCCTCAGGAAGG + Intergenic
1071884133 10:89931018-89931040 GTGAGGACACAGCAAGAAGATGG + Intergenic
1072434673 10:95404179-95404201 CTGGGGCCAGAGAATGAGGTGGG + Intronic
1072690489 10:97569722-97569744 GTGAGGACACAGCAAGAAGACGG - Intronic
1073233174 10:101990003-101990025 CTAGGCACACTGCATGAAGAGGG - Intronic
1074574061 10:114651877-114651899 CTGGGGACCCAGCATGCTGGAGG + Intronic
1075166335 10:120071288-120071310 ATGGGAACACAGCACCAGGAGGG + Intergenic
1075655276 10:124156942-124156964 CCGGGCACACAGAATGGGGAAGG + Intergenic
1075660065 10:124187247-124187269 CTGTGGAGACAGCATCTGGAGGG - Intergenic
1076603423 10:131674068-131674090 CTGGGGTCCCACCCTGAGGAAGG + Intergenic
1076662356 10:132064299-132064321 CTGGGGAAACAACACAAGGATGG - Intergenic
1076755839 10:132571169-132571191 CTGGGAATGCAGCATGAGGCAGG + Intronic
1076799981 10:132816871-132816893 CTGAGGCCACAGCGTGATGAGGG - Intronic
1077177485 11:1197330-1197352 CTGAGGACCCAGCAGGAGTAGGG - Intronic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1078258381 11:9681040-9681062 CTGAGCACACAGCATTGGGAGGG - Intronic
1078409727 11:11104380-11104402 ATGAGGACACAGCAAGAAGATGG + Intergenic
1078425101 11:11243470-11243492 ATGTGGAAACAGCATGAGGCTGG + Intergenic
1079164331 11:18024830-18024852 CTGGGGAAACAGCAAGAAGCTGG - Intronic
1080642912 11:34168144-34168166 CTGGGCACAGGGCATGGGGAAGG + Intronic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1083800683 11:65044711-65044733 CTGGGTCCCCAGCCTGAGGAGGG + Exonic
1083869352 11:65477456-65477478 CTGGGGACACGGCAGGAAGAAGG + Intergenic
1083903391 11:65654764-65654786 GTGGGGCCACAGCCTGAGGAGGG + Exonic
1083961587 11:66017587-66017609 CTGACTACACAGCATGATGAAGG - Intronic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084199086 11:67543424-67543446 CTGGGGTACCAGCATGGGGAGGG + Intergenic
1085171626 11:74454466-74454488 CTGGGGAGACAGCAGGAAGCAGG - Intergenic
1085254502 11:75164770-75164792 CTGGGGACACTGCAGCTGGACGG - Intronic
1085444149 11:76589562-76589584 CTGGGGATACAGCGTGACAAAGG + Intergenic
1086203570 11:84232643-84232665 GTGAGGACACAGCAGAAGGATGG + Intronic
1087605728 11:100375559-100375581 CTGGGGACACTGCAAGAACATGG + Intergenic
1087889989 11:103527169-103527191 TTGAGGACACAGCAAGAAGATGG - Intergenic
1088839446 11:113611598-113611620 GTGAGGACACAGCAAGAGGGAGG - Intergenic
1089389821 11:118093184-118093206 CGGTGGACACAGCAATAGGAAGG - Intronic
1089576439 11:119447698-119447720 CTGAGGACCCAGCATGTGGGAGG - Intergenic
1090037995 11:123265265-123265287 CTGGACACACAGCATCAGTAGGG + Intergenic
1090053359 11:123400590-123400612 ATGAGGACACAGCAAGAAGATGG - Intergenic
1090188478 11:124753042-124753064 CTGGGTACACAGCTTGGGAAGGG + Intronic
1090265472 11:125350695-125350717 CTGGGGCTACAGTCTGAGGACGG + Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090416994 11:126547579-126547601 GAGAGGACACAGCCTGAGGAGGG - Intronic
1090565042 11:127980983-127981005 CTGGGGGCACAGTATTAGGCAGG - Intergenic
1090860822 11:130650963-130650985 CTGTGGACTCAGAATTAGGATGG + Intergenic
1090927564 11:131262026-131262048 CTGGGGATACAGAATGAATAAGG + Intergenic
1091149277 11:133311901-133311923 CTGGGGCCACAGCCAGAGTAGGG + Intronic
1091311004 11:134575140-134575162 CTGAGGACACAGCGAGAAGACGG + Intergenic
1091810072 12:3389684-3389706 CTGGGGACACAGAAAAGGGAAGG + Intronic
1092951460 12:13507450-13507472 CTTGGCACACAGGATGGGGAGGG + Intergenic
1093013233 12:14130029-14130051 CCTGGGCCACTGCATGAGGAAGG + Intergenic
1093181546 12:15972582-15972604 CCTGGGACACATCATGAGGCAGG - Intronic
1093757166 12:22865722-22865744 CAGGGGCCACAGCGTGAGCAGGG - Intergenic
1094483072 12:30900387-30900409 CTGGGGACACAGAAAAAGCAAGG - Intergenic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1095500173 12:42829056-42829078 CTGGGGATCCAGCAGGGGGATGG + Intergenic
1096411492 12:51379872-51379894 CTGGGGCCTCAGCCTGAGAAAGG + Exonic
1096572604 12:52532473-52532495 CTGGGGCCAAGGCTTGAGGAGGG - Intergenic
1097680561 12:62645269-62645291 CTGAGAACACAGTAAGAGGAGGG + Exonic
1097680795 12:62647259-62647281 CAGGGAGCACAGCATGAGAATGG + Exonic
1098498093 12:71160151-71160173 GTGGGGGCAGAGGATGAGGAAGG - Intronic
1098606104 12:72392056-72392078 GTGAGGACAAAGCAAGAGGATGG + Intronic
1099710247 12:86214595-86214617 GTGAGGACACAGCAAGAGGCTGG - Intronic
1099987624 12:89685880-89685902 ATGAGGACACAGCAAGAAGAAGG + Intronic
1100095845 12:91035255-91035277 GTGAGGACACAGCAAGAAGATGG - Intergenic
1101051419 12:100867965-100867987 CTGGGGAAATAACATCAGGATGG + Intronic
1102259583 12:111436042-111436064 CTGGGGACAGGGCAGGTGGATGG + Intronic
1102440892 12:112963290-112963312 CTGGGGGCACAGCAGGAAGGTGG - Intronic
1103038738 12:117677408-117677430 GTAAGGACACAGCAAGAGGACGG + Intronic
1103700943 12:122848474-122848496 CTGGGCACACACCACGAGAAGGG + Exonic
1104815581 12:131643787-131643809 CTGGGGGCACAGCCTGCAGATGG + Intergenic
1104894214 12:132153899-132153921 CCTGGGACACAGCAAGAGGACGG - Intergenic
1105264960 13:18807880-18807902 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1107477693 13:40755499-40755521 CTGGGGAAACAGCCTGATGGAGG + Intronic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1107738592 13:43424727-43424749 CTGGTTACAGAGCATGAGCAAGG - Intronic
1108620749 13:52181718-52181740 CTGGGGAAACAGGCTGATGAAGG + Intergenic
1112563694 13:100534636-100534658 TTGGGGACTCAGCATTTGGAAGG + Intronic
1112655638 13:101449951-101449973 CTGGGGACACAGCAGTAGGTTGG - Intergenic
1113017110 13:105840268-105840290 CTGAGGACACAGCCAGAGGAGGG + Intergenic
1113629191 13:111869426-111869448 CTTGGGGCACAGGAAGAGGATGG - Intergenic
1113813806 13:113158366-113158388 CTGGGGACACAGCACTGGGCGGG - Intergenic
1113890713 13:113734331-113734353 AAGGGGTCACAGGATGAGGAGGG + Intronic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1115490106 14:33950725-33950747 CCTGGGACACATCATGAGGCTGG - Exonic
1115566538 14:34629843-34629865 CCGGGGACCCAGGATGGGGAAGG + Intronic
1117205235 14:53435616-53435638 GTGGTGGCACAGCATGAGCATGG + Intergenic
1117894576 14:60469225-60469247 CTGAGGAGAGAACATGAGGAAGG - Intronic
1117904139 14:60566701-60566723 CTGGGTTGACAGGATGAGGAAGG + Intergenic
1118010927 14:61609738-61609760 CTGGAGACACAGCAGAGGGAAGG - Intronic
1119562164 14:75599211-75599233 CTGGAGGCACAGCATGGGGGAGG - Intronic
1119766931 14:77196144-77196166 CTGGGGACTGATCAAGAGGAGGG + Intronic
1120219265 14:81714126-81714148 CTGGGGACAAAGCATAAACAAGG + Intergenic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120754888 14:88233502-88233524 CTGGGGACAAAGCATGGGGAAGG + Intronic
1120865719 14:89293802-89293824 CTGGAGAGACTGCATGTGGAAGG - Intronic
1121148791 14:91610932-91610954 ATGAGGACACAGCAAGAAGATGG + Intronic
1121678066 14:95770491-95770513 GTGAGGACACAGCAAGAAGATGG + Intergenic
1121852029 14:97230117-97230139 GTGGAGACACAGCATCTGGAAGG - Intergenic
1122293533 14:100692611-100692633 CTGGGGACTCAGCCTGGGGCAGG - Intergenic
1122474069 14:101993715-101993737 GTGTGGGCACAGCATGGGGAAGG - Intronic
1122789112 14:104176928-104176950 CCGGGTTCACAGCATGCGGAGGG - Exonic
1202833504 14_GL000009v2_random:60234-60256 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1123991091 15:25683882-25683904 CTGGGGTCACAGACAGAGGAGGG - Intronic
1124019331 15:25904908-25904930 CTGGGTACCCAGCATGAGTGGGG + Intergenic
1124988443 15:34646355-34646377 ATGGGGACACAACATAAGGGTGG - Intergenic
1125504549 15:40259339-40259361 CTGAGGACACAGCCTGATGCTGG + Intronic
1125832840 15:42728733-42728755 CTGGTGACACAGGGAGAGGAAGG - Exonic
1127800835 15:62476208-62476230 CAGGTGACAAAGCAGGAGGAGGG - Intronic
1128551965 15:68603693-68603715 CAGAGGACACAGCAAGAAGACGG + Intronic
1128929930 15:71695132-71695154 ATTGGGACACAGCCTGTGGAAGG - Intronic
1129514147 15:76146683-76146705 CTGGGGACAAAGAAAAAGGAGGG + Intronic
1130107802 15:80942178-80942200 CTGGGGATACGGGAAGAGGAGGG + Intronic
1130798812 15:87239292-87239314 CTGGGGGCATAGCATGAGGAGGG + Intergenic
1131653146 15:94423988-94424010 CTGGGGACAAAGCAGGAAGGAGG - Intronic
1131781710 15:95866724-95866746 CTGTGGACCAAGCAGGAGGAAGG + Intergenic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132732249 16:1368144-1368166 CTGGGACCACACCATGAGGTGGG + Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1132975620 16:2709825-2709847 CTGGGTGCCCAGCATGAGGCCGG + Intergenic
1133875926 16:9734267-9734289 CTGGCGAAACAGCAAGAGGGAGG - Intergenic
1133887515 16:9844347-9844369 TTGGGGACACAGGATGAAAAAGG + Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1135488579 16:22887375-22887397 GTGAGGACACAGCAAGAAGATGG - Intronic
1136374663 16:29858540-29858562 GTGGGGACACCACATGAGCATGG + Exonic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1138681452 16:58686240-58686262 GTGAGGACACAGCAGGAAGATGG - Intergenic
1139526807 16:67521721-67521743 CTGGGGACACCGCCTGAGGCTGG - Intronic
1139653807 16:68375655-68375677 CTGGGATCACAGCAGGAGAAAGG - Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141424211 16:83934920-83934942 CTGGAGACACAACATCAGAAGGG - Intronic
1141623026 16:85247233-85247255 CTGGGGACAGAGCATGGACAGGG - Intergenic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1141859486 16:86706714-86706736 CTAAGGACACAGGATGAGAAAGG - Intergenic
1141979667 16:87542101-87542123 CTGGGGACACAGGTTGGGGGTGG + Intergenic
1142116920 16:88362302-88362324 ATGGGTGAACAGCATGAGGATGG - Intergenic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1142420495 16:89966718-89966740 CTGTGGCCCCAGCCTGAGGAGGG + Exonic
1143028923 17:3956649-3956671 CCTGGGTCACAGAATGAGGAAGG + Intronic
1143141110 17:4742308-4742330 CTGGGGACACAGCGGGTGGTGGG - Intronic
1143444369 17:6998685-6998707 TTGGGGACAAAGCTTCAGGAAGG - Intronic
1143553857 17:7648858-7648880 TTGGGGACACAGCATGGGTGTGG - Intronic
1143829932 17:9643492-9643514 CTGTGCACAGATCATGAGGAAGG - Intergenic
1144579236 17:16448764-16448786 TTGAGGACACAGGAGGAGGAGGG + Intronic
1144588719 17:16505517-16505539 GTGAGAACACAGCATGAAGACGG + Intergenic
1144628214 17:16856348-16856370 ATGGTGACACACCAGGAGGAGGG + Intergenic
1144876844 17:18401589-18401611 CTGGGGAGATAGCAAGAGAAAGG - Intergenic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1145155386 17:20542829-20542851 CTGGGGAGATAGCAAGAGAAAGG + Intergenic
1145159806 17:20566915-20566937 ATGGCGACACACCAGGAGGAGGG + Intergenic
1146287208 17:31582011-31582033 TTTGGGTCACAGCCTGAGGATGG + Intergenic
1146551150 17:33781419-33781441 CTGGGGACAGCGCAGGATGATGG + Intronic
1146625538 17:34432283-34432305 GTGAGGACACAGCAAGACGATGG + Intergenic
1147177800 17:38667296-38667318 CTCAGGACACAACATGAGGTAGG - Intergenic
1148087647 17:45004091-45004113 CTGGTGCCTCAGCATGAGGCCGG + Intergenic
1148322915 17:46768418-46768440 CCGGGGCCACAACACGAGGACGG - Exonic
1148584707 17:48769157-48769179 CTGAGGACTCTGCAAGAGGAGGG + Exonic
1148805037 17:50259700-50259722 CTGGGGCCACAGAGTGGGGAGGG - Intergenic
1150773575 17:68061672-68061694 CTCCGGACACAGAATGAGGCTGG + Intergenic
1151345580 17:73499400-73499422 CTGGGGACCCAGCCTGGGGCCGG + Intronic
1151478012 17:74354678-74354700 CTGGGGACAGAGACTGTGGAGGG - Intronic
1151560391 17:74866636-74866658 CTGGGGACACAGAGTGGTGAGGG - Intronic
1152073152 17:78143985-78144007 CTGGGGACACAGTATGGGGGAGG + Intergenic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152367467 17:79864881-79864903 CAGAGGCCACAGCAGGAGGAGGG - Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1154394546 18:13975012-13975034 ATGAGGAGACAGCAAGAGGATGG + Intergenic
1154423433 18:14253663-14253685 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1154973097 18:21429995-21430017 GTGAGGACACAGCAAGAAGACGG - Intronic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1156245655 18:35295377-35295399 CTGGGGGAAAAGTATGAGGATGG - Intergenic
1156723689 18:40101778-40101800 GTGAGGACACAGCATGATGCTGG - Intergenic
1157036127 18:43976725-43976747 CTGAAAACACAGCATGCGGAGGG - Intergenic
1157330670 18:46701562-46701584 ATAGGGACACAGCAAGAAGAAGG + Intronic
1158316049 18:56212355-56212377 CTAGGTGCACAGCATGAGCAAGG - Intergenic
1158808396 18:61002596-61002618 CTGAGGACACAGCAAGAAGAAGG + Intergenic
1159636110 18:70806855-70806877 CTGGGGAAACAGCAAGAGAGAGG - Intergenic
1159923387 18:74246717-74246739 ATGGGGAGATAGCAGGAGGATGG - Intergenic
1160462033 18:79046667-79046689 CTGGAGCGACAGCATGAGAAGGG + Intergenic
1160599981 18:80005155-80005177 CTGGGGGAACAGCATGCAGAGGG + Intronic
1161814583 19:6492014-6492036 CTGGGGGCTCAGCAGGAGTAAGG - Intergenic
1162616398 19:11804282-11804304 GTGAGGACACAGCAAGAGGATGG - Intronic
1162758587 19:12874798-12874820 CTGGGGGCACAGCTTCAGCAGGG - Exonic
1162833331 19:13300331-13300353 CTGGGGATACAGCATTAACAAGG - Intronic
1162956765 19:14103067-14103089 CTGAGGACACAGCATCAGGGAGG + Intronic
1163354438 19:16800682-16800704 CTGGGGACACATCAAGAAGATGG - Intronic
1163534482 19:17869308-17869330 CTGGGGACACAGCATGATCCAGG - Intergenic
1164131556 19:22367446-22367468 CTGGGCACACAGCTAGAGGAAGG + Intergenic
1164717929 19:30407075-30407097 CTGGGGTCACAGCAGGTGGCTGG + Intronic
1165341778 19:35217692-35217714 GTGAGGACACAGCAAGAAGATGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165595477 19:37008784-37008806 CGGGAGACACAGCAAGAGGGAGG - Intronic
1165743394 19:38216784-38216806 CTTGGTAGACAGCTTGAGGAAGG + Intronic
1165825383 19:38702793-38702815 CCGGGGACACACCCAGAGGAAGG - Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166376629 19:42331091-42331113 CTGGTGAGACAGGATGAGGCCGG + Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166741062 19:45115088-45115110 CTGGGGACACAGCAGTGGCAAGG + Intronic
1167096905 19:47379526-47379548 CTGGGGATACGGCATGAACAAGG - Intronic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167719360 19:51168051-51168073 GTGGGGACGCAGGATCAGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG + Intronic
1168111854 19:54196869-54196891 CTGGGGATACTGCATGAACAAGG - Intergenic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
1168321506 19:55513041-55513063 CGTGGGACACACCATCAGGAAGG + Exonic
1168401793 19:56089452-56089474 CCGGGGGCAGAGGATGAGGAAGG + Intronic
1202639166 1_KI270706v1_random:67461-67483 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
925180781 2:1815685-1815707 CTGGGGGCAGGGCATGGGGAAGG - Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926906428 2:17809969-17809991 CAGCAGACACAGCAAGAGGATGG - Intergenic
927204186 2:20596758-20596780 CTTCAGACACAGCAGGAGGAAGG - Intronic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
927851822 2:26504280-26504302 CTGGAGACAGAGCATCAGAACGG + Intronic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928320434 2:30278957-30278979 CAGAGGACACAGCAAGAGGTTGG - Intronic
928662551 2:33517918-33517940 CTGTGGATATAGCATGAGCAAGG - Intronic
929470748 2:42190263-42190285 GGGGGGACTCAGCAGGAGGAGGG - Intronic
929700882 2:44161961-44161983 CTGAGGACACATCAAGAGGATGG + Intergenic
929881506 2:45840943-45840965 CTGGGGACAGAGCCTTGGGAGGG + Intronic
931246960 2:60499769-60499791 CCTGGGCCACAGCATGTGGAAGG + Intronic
931263237 2:60638345-60638367 CTGGAGTCCCTGCATGAGGAGGG + Intergenic
931431768 2:62214224-62214246 CTGTGGGAACAGCATGAGCAGGG + Intronic
931632747 2:64316028-64316050 CTGAGAAAACAGCATCAGGATGG - Intergenic
931935117 2:67188082-67188104 CTGGGGACAAAGCCTGAGCTTGG + Intergenic
932126305 2:69148245-69148267 CTGGGAGCACAGCATGAGTGCGG - Intronic
932743097 2:74307039-74307061 CTTGGGAAACAGCCTGAGGGAGG - Intronic
932753591 2:74389094-74389116 CCTGGGAAACAGCATTAGGAAGG + Intronic
932764268 2:74460285-74460307 CTGGGGCCACAGTATAAGGGGGG - Exonic
933968004 2:87445930-87445952 CCTGGGACACAGCAAGAAGAAGG - Intergenic
934513139 2:94964348-94964370 CAGGGGACACAGAATCACGATGG - Intergenic
934985471 2:98881784-98881806 CTGGGCACACAGCATCATGGCGG + Intronic
936072787 2:109382518-109382540 CTGGGGACACAGCTGCAAGACGG - Intronic
936735347 2:115435179-115435201 CTGGGTACACAGCCTAAGAAAGG - Intronic
936867117 2:117087527-117087549 TTGGGGAGTCAGCATGATGAGGG - Intergenic
938265737 2:129926912-129926934 CTGGAAACACAGCATGGGAAAGG + Intergenic
938374856 2:130798458-130798480 CTGGGTACACAGCAGGACAATGG + Intergenic
938378793 2:130825310-130825332 ATGGGCAGACAGCATGAGGGAGG - Intergenic
939029847 2:137059135-137059157 GTGAGGACACAGCAAGAAGATGG - Intronic
939862281 2:147434648-147434670 ATGAGGACACAGCAAGAAGATGG - Intergenic
940997444 2:160164999-160165021 CTGGGAACAAAGACTGAGGAGGG - Intronic
942525493 2:176848856-176848878 CTGTGGACACAACCTGTGGAAGG - Intergenic
943993003 2:194721349-194721371 CTGGGGACACTCAATGAGTAAGG + Intergenic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
945406480 2:209454985-209455007 GTGGGGACACAGCAAGAAGATGG - Intronic
945416320 2:209577346-209577368 CTGGGGAGAGAGGATGATGATGG + Intronic
945756498 2:213853874-213853896 TTGTGGACAAAGCTTGAGGAGGG + Intronic
945837882 2:214853944-214853966 GTGAGGACACAGCAGGAAGATGG + Intergenic
946417299 2:219546519-219546541 CTGGGATCACAGTATGGGGAGGG - Intronic
946602889 2:221371467-221371489 CTGGCGACGGAGCAGGAGGAAGG - Intergenic
947301998 2:228698033-228698055 CTGAAGACAAAGCAGGAGGAAGG + Intergenic
947536304 2:230942327-230942349 CTGGGGACACTCCCTGAGGGAGG - Intronic
947654327 2:231813371-231813393 GTGAGGACACAGCAAGAAGATGG - Intergenic
947722939 2:232380341-232380363 CAGGGGGCACAGCAGGGGGAGGG + Intronic
947750341 2:232528798-232528820 CTGGGGCCACAGAGTGGGGAAGG - Intronic
947982909 2:234425537-234425559 CTGGGGACACAGCACGGGTGAGG + Intergenic
948443736 2:238015931-238015953 GGGGGTACACAGCATGTGGATGG + Intronic
948524845 2:238565096-238565118 GTGAGGACACAGCGGGAGGATGG + Intergenic
948815503 2:240508165-240508187 CTGGGCACACAGCAGGGAGAAGG - Intronic
948827189 2:240578421-240578443 CAGGGGACACAGGGAGAGGATGG + Exonic
1170455188 20:16526167-16526189 CTGGGGACTCAGGAAGAGAACGG - Exonic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1171333698 20:24363546-24363568 TTCGGGACAGAGAATGAGGATGG + Intergenic
1171885758 20:30651576-30651598 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1172837520 20:37882568-37882590 CCGGGGACACAGAGTCAGGAGGG + Intergenic
1173147107 20:40534465-40534487 CTGGTGACACAACATGAGAGGGG + Intergenic
1173225530 20:41160355-41160377 CAGGGCACACAGCATGTGGCTGG - Intronic
1174752214 20:53122836-53122858 TGGGGGACAGGGCATGAGGAAGG + Intronic
1175482828 20:59323479-59323501 CTGGGGACATAGCAGGAACAAGG + Intronic
1175680988 20:60988726-60988748 GTGAGGACACAGCAAGAGAATGG + Intergenic
1175801260 20:61802230-61802252 CTGGGAACAGAGCATGATCAGGG - Intronic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1175970283 20:62682892-62682914 AGCTGGACACAGCATGAGGACGG + Intronic
1176000328 20:62828741-62828763 CTGGGGACAAGGGATGAGTAAGG - Intronic
1176079680 20:63266006-63266028 CTGGGGTCTCAGGATGAAGACGG + Intronic
1176647489 21:9365070-9365092 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1176850036 21:13906346-13906368 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1177735763 21:25086703-25086725 CTGAGGACACAGGAAGAAGAGGG + Intergenic
1178231459 21:30789759-30789781 GTGGGGACACAGCAAGAAGATGG + Intergenic
1179008018 21:37531592-37531614 CTGGGGGCACAGCAAGAACAGGG - Intergenic
1180082601 21:45493623-45493645 CTGTGGAGACAGCCTGGGGAGGG + Intronic
1180362784 22:11914403-11914425 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1180713223 22:17854205-17854227 CTGTTGACACAGCTTGGGGAGGG + Intronic
1181980190 22:26760621-26760643 CTGTGGACACAGCATGGTGTTGG + Intergenic
1182044545 22:27264100-27264122 CAGAGGAGACAGCATGTGGAAGG + Intergenic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1183060643 22:35334518-35334540 ATGGTGGCACACCATGAGGAAGG + Intronic
1183334943 22:37241188-37241210 CTGGGGACAAGGCATGCTGAGGG - Intronic
1183411985 22:37660264-37660286 GTGGGGACACAGGAGGTGGAGGG - Intronic
1183742269 22:39675380-39675402 CAGGGGTCAGAGCATGGGGAAGG - Intronic
1184515199 22:44957457-44957479 CTCTGGAGGCAGCATGAGGACGG - Intronic
1184799995 22:46753299-46753321 CTGGGGACACTGCAAGGGGTGGG - Intergenic
1185391392 22:50563187-50563209 CTGGGGACACAGCAGGCAAACGG - Intergenic
949433326 3:4002095-4002117 CTGGGAAAACTGCATGAGGGTGG + Intronic
949824799 3:8154263-8154285 CTTGGGACCCAGGATGAGGTTGG - Intergenic
950011908 3:9729956-9729978 CTGGGGCCACATCAAGAGGGAGG + Intergenic
950193205 3:10992307-10992329 CTGGTGACCCAGGATGAGGCCGG + Intergenic
950651759 3:14411587-14411609 CTGGGGACACATCAAGGGGAGGG + Intronic
951318762 3:21219651-21219673 CTGAAGACACAGCATAAGTATGG - Intergenic
952330786 3:32362805-32362827 CTGGAGACAGAGCAACAGGAAGG - Intronic
952678348 3:36060596-36060618 CTGGGGTGACATCAGGAGGATGG - Intergenic
952840438 3:37641150-37641172 CCGGCCACACAGCATGAGGTGGG + Intronic
953235698 3:41104197-41104219 CTGGGGACACAGAAAGGGGCGGG + Intergenic
953383672 3:42492708-42492730 CTGGGGACCCAGGAGGAGAAGGG + Intronic
953545542 3:43861520-43861542 CTGGGAACACAGTAAGAGGAAGG + Intergenic
954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG + Intronic
955003543 3:54949065-54949087 CTGGGGGCACTGGATGAGGAAGG - Intronic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955751154 3:62186460-62186482 ATGGGCACACAGGGTGAGGAGGG + Intronic
955756822 3:62233352-62233374 CTGGGGAGAGAGCATGGGGAAGG - Intronic
956326193 3:68055566-68055588 GTGGGGACAGATCTTGAGGAAGG + Intronic
957137418 3:76307164-76307186 CTGAGGAAATAGCATGAGCATGG - Intronic
957610383 3:82458461-82458483 TTAGGAAAACAGCATGAGGATGG - Intergenic
959476243 3:106815487-106815509 CAGGGGACTCAGCATCTGGAGGG - Intergenic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
961014072 3:123454036-123454058 CTGGGGGCAGAGGAGGAGGAGGG - Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961330667 3:126136069-126136091 CTTGGGACGGAGCATCAGGAGGG - Intronic
961367131 3:126407095-126407117 CTGTGAACACAGCCTGAGGCGGG - Intronic
961534292 3:127560197-127560219 CTGGGGACACAGGAAGTGCAGGG - Intergenic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
964713713 3:159699121-159699143 CTAGGAACATAGCATGAGTATGG + Intronic
964857095 3:161158320-161158342 TTAGGGACACAGTGTGAGGAAGG - Intronic
965559736 3:170049801-170049823 TTGTGGACACACCCTGAGGAAGG - Intronic
966008459 3:175047012-175047034 CTGAGGACACAGTAAGAAGATGG - Intronic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
967130289 3:186464545-186464567 CTGGGGACAAAGCATGTAGATGG + Intergenic
967582639 3:191178274-191178296 ATGGGAACACAGCATAAGGTGGG + Intergenic
1202739390 3_GL000221v1_random:39917-39939 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
968502137 4:955732-955754 CTGGGGACACGCCAGGAGGGTGG - Intronic
968506818 4:974552-974574 CCGGGGACCCAGTCTGAGGAGGG + Intronic
968568169 4:1325955-1325977 CTAGGGACACAGGGTGATGAGGG + Intronic
968646536 4:1743962-1743984 CTGGGGGCACTGCAGGAAGAAGG + Intronic
969144811 4:5113240-5113262 GTGAGGACACAGCAAGAAGATGG + Intronic
969221194 4:5759816-5759838 CCTGGGACACAGCCTCAGGAGGG + Intronic
969431652 4:7158523-7158545 CCTGGGACACAGCCTCAGGAGGG - Intergenic
969588954 4:8110393-8110415 CTGAGGTCACAGCATGCAGAAGG - Intronic
969912942 4:10461754-10461776 CTTGGGACATAGCAGGAGCATGG + Intergenic
970475001 4:16413036-16413058 GTGGCCACACAGCAGGAGGATGG - Intergenic
970614916 4:17760028-17760050 TAGGGGACACAGCATGATGCAGG - Intronic
970682572 4:18527649-18527671 GTGAGGACACAGCAAGAAGATGG - Intergenic
970815377 4:20150094-20150116 GTGGGGACACAAAAGGAGGAAGG - Intergenic
970974131 4:22023413-22023435 CTGGGGACACAGGTTGAGGCTGG + Intergenic
971692709 4:29858288-29858310 CCGGTGACACAGCCTCAGGAGGG - Intergenic
972408675 4:38769966-38769988 ATGGAGACAAAGCATGGGGAAGG - Intergenic
973369403 4:49233821-49233843 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
975528191 4:75373947-75373969 CTGAGGACACAGCTAGAGGGAGG + Intergenic
976382318 4:84413666-84413688 CTGGGAAGACAGCATGAAGAGGG + Intergenic
976587117 4:86811372-86811394 CTGGGGACAGAGTTTGAGAATGG + Intronic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
981162767 4:141518690-141518712 CTGGGGACACAGCTTCTGGCAGG - Intergenic
981551761 4:145948646-145948668 CTGGGGATAGAGCCTGAAGAAGG - Intergenic
981715102 4:147744863-147744885 CTGGAGACACACCATATGGATGG + Intronic
981719900 4:147790924-147790946 GTAAGGACACAGGATGAGGAGGG - Intronic
982951195 4:161698158-161698180 GTGAGGACACAGCAAGAAGATGG + Intronic
983052539 4:163065596-163065618 ATGAGGACACAGCAAGAAGATGG + Intergenic
983930396 4:173447208-173447230 GTGAGGACACAGCAAGAAGATGG - Intergenic
984210078 4:176836590-176836612 CTGAGGACACAGCGAGAAGATGG + Intergenic
984769605 4:183425945-183425967 CTGAGGACACAGGAGGGGGAGGG - Intergenic
985009649 4:185569254-185569276 CTGGGGAGACTGCCTGAAGAGGG + Intergenic
1202766516 4_GL000008v2_random:153331-153353 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
986720243 5:10555944-10555966 GGGAGGACACAGCAGGAGGATGG + Intergenic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989118180 5:37977092-37977114 GTGAGGACACAGCAAGAGGATGG + Intergenic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
990868321 5:60403754-60403776 CTGGAGAGACAGCATCAGGAAGG - Intronic
990988490 5:61662312-61662334 CTGCGGTCACAGGAAGAGGATGG + Intronic
991085665 5:62646568-62646590 GTGAGGACACACCATGGGGATGG + Intergenic
992110579 5:73488784-73488806 ATGAGGACACAGCAAGAAGATGG - Intergenic
992675579 5:79102537-79102559 CTGGGGACATAGTGAGAGGAGGG + Intronic
992748784 5:79843230-79843252 CTGGGGACCCAGCAGCAGCAAGG + Intergenic
992756309 5:79909897-79909919 CTGGGGAAAAGGCATGAGAAGGG - Intergenic
995906791 5:117134365-117134387 CTGGGGAAAAAGGATCAGGAGGG + Intergenic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1001199347 5:169701865-169701887 CTAGGGACACAGGGTTAGGAGGG - Intronic
1003408991 6:5846799-5846821 CTGGGGAAACAGCCTGAGACAGG + Intergenic
1003762762 6:9198908-9198930 CTGGTGACTCAGCAAGAAGAGGG - Intergenic
1004251035 6:14023354-14023376 CTGGGGCCACACCCTGAGGACGG - Intergenic
1004568445 6:16821671-16821693 GTAGGGACACAGAATGATGATGG + Intergenic
1005161163 6:22865724-22865746 TTGAGGACACAGCAAGAGGATGG - Intergenic
1005984743 6:30864365-30864387 CTGAGCACACAGCTTCAGGAGGG - Intergenic
1006013221 6:31059611-31059633 CTGGGACCACCACATGAGGAAGG + Intergenic
1006088918 6:31616321-31616343 CTGGGGGCAGAGGATGGGGATGG - Intronic
1006335123 6:33416362-33416384 CTGGGGGCAGAGACTGAGGAGGG + Exonic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1007654908 6:43446042-43446064 CTGGGGACAAGGGATGGGGAAGG + Intronic
1007960497 6:45954710-45954732 CTGGGAACATAGCATGGGAAAGG + Intronic
1008870843 6:56270791-56270813 CAGGAGACAGAGCATGAGGGAGG - Intronic
1009288336 6:61851583-61851605 CTAAGGACACAGCAGGAAGATGG + Intronic
1009323345 6:62318304-62318326 GTGAGGACACAGCAGGAAGATGG + Intergenic
1009450314 6:63792182-63792204 CTGGGGATGCACCAAGAGGAGGG + Intronic
1009488376 6:64254614-64254636 CAGGGAACAAAGCAAGAGGAAGG - Intronic
1009641062 6:66337445-66337467 GTGAGGACACAGCAAGAAGAAGG - Intergenic
1011668407 6:89658406-89658428 CTGGGGGAACAGCATAAGGTGGG + Intronic
1011696932 6:89921359-89921381 CTGGGCACACTGCTTGAGGGAGG + Intergenic
1011783692 6:90819503-90819525 CTGGGACGACAGCATGAGGCTGG - Intergenic
1012272330 6:97229184-97229206 CTGGGCATACATCAAGAGGAAGG + Exonic
1013300870 6:108803868-108803890 CTGGTGACCCAGCAAGAGCAAGG + Intergenic
1013482055 6:110561407-110561429 CTGGGAACACAGCATGAACAAGG + Intergenic
1014806650 6:125837730-125837752 CTTAGGAGGCAGCATGAGGAAGG + Intronic
1016388037 6:143548161-143548183 GTGAGGACACAGCAAGAAGATGG - Intronic
1017018284 6:150118711-150118733 CTGCGGGCACAGCCTGGGGAAGG + Intergenic
1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG + Intronic
1018393526 6:163359294-163359316 CTGCGGACACAGGATGAGGGAGG + Intergenic
1018726832 6:166619213-166619235 CCCGAGACACAGCATGAGGTTGG - Intronic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019182745 6:170201609-170201631 GTGAGGACACAGCAAGAAGATGG - Intergenic
1019191366 6:170252960-170252982 CTTTGGAGACAGCCTGAGGAAGG - Intergenic
1019315496 7:382436-382458 CTGAGGACACAGCAGTAGAATGG + Intergenic
1019694414 7:2437172-2437194 GTGTGGACACAGCTGGAGGATGG - Intergenic
1020530661 7:9329909-9329931 GTGAGGACACAGCAAGAAGATGG + Intergenic
1020835300 7:13142102-13142124 ATGAGGACACAGCAAGAAGACGG + Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021274725 7:18636265-18636287 CAGGGGACACAGCAGTAAGAGGG - Intronic
1021489778 7:21207016-21207038 GTGGAGACACATCATGAGAAGGG - Intergenic
1021651894 7:22840680-22840702 CTGAGAACCCAGCATGTGGACGG - Intergenic
1022652766 7:32292734-32292756 CTTGGAACACAGCAGGAGGAGGG - Intronic
1023895646 7:44430933-44430955 CTGAGGACACGGCAGGAGGATGG - Intronic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1026853274 7:73737833-73737855 CTGGGGATACACCCTGTGGAGGG + Intronic
1027131195 7:75592484-75592506 CTGGGCACCCACCATGAGAAAGG - Exonic
1027965435 7:84999675-84999697 CAGAGGGCAGAGCATGAGGAGGG - Exonic
1028270259 7:88779362-88779384 CTGAGGCCAGAGGATGAGGAAGG + Intronic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1029663387 7:101978634-101978656 GTGGGGTCACAGAATGTGGAAGG - Intronic
1030800302 7:113841992-113842014 ATGGGCACAGAGCATGAGGAGGG - Intergenic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032429426 7:131848879-131848901 CTGGGGACAGTACATGGGGAGGG - Intergenic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035892500 8:3360483-3360505 CTGGGGAAACAGCAAGAAGGAGG - Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036487332 8:9191377-9191399 GTGGGGACAGAGCATGGAGATGG - Intergenic
1036764367 8:11537983-11538005 CGGGGGAGTCAGCAAGAGGAGGG - Intronic
1037219082 8:16495350-16495372 CTGAGTACACAGCAAGAAGACGG + Intronic
1037373445 8:18204346-18204368 CTTGGGACCCAGGATGAGTAGGG + Intronic
1037489524 8:19385105-19385127 CTGGGACCAAAGCACGAGGAGGG - Intronic
1037831838 8:22194420-22194442 GTGGGGACACAGGATGGGGTGGG - Intronic
1038286840 8:26212819-26212841 CTGAGGACACAGTAAGAAGACGG + Intergenic
1038440446 8:27567650-27567672 CTGGGGCCAAATCTTGAGGAAGG - Intergenic
1038726130 8:30083970-30083992 CTGGGGACACAACTTCAGGGAGG + Intergenic
1039064781 8:33598904-33598926 ATGGGGACAGAGCATGGGCAGGG - Intronic
1039722973 8:40184680-40184702 GTGAGGACACAGCAAGAAGACGG + Intergenic
1039847610 8:41336849-41336871 CTTGGGAGAGAGTATGAGGAAGG - Intergenic
1039873593 8:41567330-41567352 CTGCGGGCACAGCCTGAAGAGGG + Intergenic
1040767370 8:50929076-50929098 GTGGGGACACAGCATGAAAGTGG + Intergenic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1041970953 8:63742172-63742194 CTGAGGACACAGCACGAAGGTGG + Intergenic
1042058774 8:64794542-64794564 GTGAGGACACAGCAAGAAGATGG - Intronic
1042850582 8:73212253-73212275 TTGGGTAGACAGGATGAGGAAGG - Intergenic
1043713811 8:83455688-83455710 CTGGGGTCAGAGCATGAACAGGG - Intergenic
1043856820 8:85274091-85274113 CTTGGGACTGAGCCTGAGGAGGG + Intronic
1044544903 8:93448777-93448799 ATGAGGACACAGCAAGAAGATGG + Intergenic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1046162814 8:110389429-110389451 CTGGGTACACAACATAATGAAGG - Intergenic
1047202025 8:122775503-122775525 GTGAGGACACAGCAAGAAGATGG - Intergenic
1047757027 8:127926697-127926719 CCGGGGACAGATCCTGAGGAGGG - Intergenic
1048223777 8:132566093-132566115 CTGGGCACACAGCATGGTGAAGG - Intergenic
1048259052 8:132930274-132930296 GTGAGGAATCAGCATGAGGATGG + Intronic
1048635126 8:136287073-136287095 GTGAGGACACAGTGTGAGGATGG + Intergenic
1048654192 8:136517232-136517254 CTGAGGAAACAGCATGAGTCTGG - Intergenic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1048999013 8:139813028-139813050 CTGAGAAGACAGCCTGAGGAAGG - Intronic
1049001277 8:139826883-139826905 CCGGAGACACACCATGGGGAGGG + Intronic
1049240856 8:141536802-141536824 CTGGGGACAAAGCCTGACAAAGG - Intergenic
1049252583 8:141597173-141597195 CGGGGAACAGAGCATGTGGAAGG - Intergenic
1049274355 8:141712230-141712252 CTCAGGAAACAACATGAGGACGG - Intergenic
1049552466 8:143266985-143267007 CTGCGGACACATCCCGAGGAGGG + Intronic
1049613141 8:143565079-143565101 CTGGGGACACAGCATCCCCATGG + Intergenic
1050385732 9:5088745-5088767 GTGAGGACACAGCAAGAAGATGG - Intronic
1051740627 9:20248487-20248509 GTGAGGACACAGCAGGAAGATGG - Intergenic
1052877287 9:33576370-33576392 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1053498715 9:38568024-38568046 CTGGAGACAGGGCAAGAGGAAGG - Intronic
1053662477 9:40293281-40293303 CTGGAGACAGGGCAAGAGGAAGG + Intronic
1053912931 9:42923456-42923478 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1054374606 9:64439506-64439528 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1054740723 9:68803543-68803565 CTTGGGAGACAGCATGAGCAGGG - Intronic
1054741618 9:68811579-68811601 CTGGGGTCAGAACATCAGGACGG - Intronic
1055013130 9:71589135-71589157 ATGGGAACACTGCATGAGAAGGG - Intergenic
1055986728 9:82061328-82061350 CTGGGGACACACCTTGACAAAGG - Intergenic
1056459369 9:86794776-86794798 GTGGGGAGAAAGAATGAGGAGGG + Intergenic
1057161768 9:92894322-92894344 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1057678166 9:97152517-97152539 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1058892316 9:109371481-109371503 TTGAGGACACAGCAGGAAGATGG + Intergenic
1059489107 9:114652537-114652559 CAGGGGATACAGTATGAGAATGG + Intergenic
1060209284 9:121700047-121700069 CTGGGGGCACAGCCTGAGGCTGG + Intronic
1060798139 9:126526488-126526510 CTGGGATCACGGCAGGAGGAAGG + Intergenic
1060962587 9:127691546-127691568 CTGTGGACACAGGCTGGGGAGGG - Exonic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061408091 9:130403617-130403639 CTGGGGTCACAGAATGACCAAGG - Intronic
1061423518 9:130485012-130485034 CTGGGGGCTCAGGAAGAGGAGGG + Intronic
1061719848 9:132544835-132544857 ATGGGGACGCTGCCTGAGGAGGG + Intronic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062075887 9:134589816-134589838 CTGAGGAGACAGCAGGAGGTGGG - Intergenic
1062195917 9:135273992-135274014 CTGGGGACAGAGCACGTGGCAGG + Intergenic
1062387189 9:136317408-136317430 ATGAGGACACAGCACGGGGATGG + Intergenic
1062610059 9:137369552-137369574 CTGGGGACACAGCAAGGGGCAGG + Intronic
1203768183 EBV:37235-37257 CCGGGGACAGAGCAGGGGGAGGG + Intergenic
1203708033 Un_KI270742v1:69866-69888 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1203547271 Un_KI270743v1:138209-138231 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1186421881 X:9433095-9433117 ATGGGGACACAGCCCAAGGATGG - Intergenic
1188266357 X:28080716-28080738 GTGAGGACACAGCAAGAGGGTGG + Intergenic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1189118759 X:38370936-38370958 CATGGCACCCAGCATGAGGAAGG - Intronic
1189497130 X:41518953-41518975 CAAGGGATACAGCAAGAGGAAGG + Intronic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1193533057 X:82679439-82679461 CTGAGGACACAGCAAAAAGATGG + Intergenic
1194597524 X:95877167-95877189 GTGAGGACACAGCAAGAAGATGG - Intergenic
1195300265 X:103523318-103523340 CTGGGGACAGGGCAATAGGAGGG + Intergenic
1197206636 X:123796780-123796802 CTAAGGACAGAGTATGAGGATGG - Intergenic
1198743001 X:139860914-139860936 CTGAGATCAAAGCATGAGGAAGG + Intronic
1199683019 X:150240426-150240448 TGGGGGACACAGCAGGAGCAAGG + Intergenic
1200238878 X:154483333-154483355 CTGGGGATTCTGCATGAAGATGG - Intergenic
1200247699 X:154534735-154534757 CCGGGGACCCAGCATGAGGCAGG - Intronic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic