ID: 1141780866

View in Genome Browser
Species Human (GRCh38)
Location 16:86159866-86159888
Sequence AAATATCCATAGCTTGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141780866_1141780869 3 Left 1141780866 16:86159866-86159888 CCTAGCTCAAGCTATGGATATTT No data
Right 1141780869 16:86159892-86159914 GCACCCAAAAGAGGCTCTCTGGG No data
1141780866_1141780873 21 Left 1141780866 16:86159866-86159888 CCTAGCTCAAGCTATGGATATTT No data
Right 1141780873 16:86159910-86159932 CTGGGGTTCCTCTCCAGTCAAGG No data
1141780866_1141780867 -6 Left 1141780866 16:86159866-86159888 CCTAGCTCAAGCTATGGATATTT No data
Right 1141780867 16:86159883-86159905 ATATTTCTAGCACCCAAAAGAGG No data
1141780866_1141780868 2 Left 1141780866 16:86159866-86159888 CCTAGCTCAAGCTATGGATATTT No data
Right 1141780868 16:86159891-86159913 AGCACCCAAAAGAGGCTCTCTGG No data
1141780866_1141780870 4 Left 1141780866 16:86159866-86159888 CCTAGCTCAAGCTATGGATATTT No data
Right 1141780870 16:86159893-86159915 CACCCAAAAGAGGCTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141780866 Original CRISPR AAATATCCATAGCTTGAGCT AGG (reversed) Intergenic
No off target data available for this crispr