ID: 1141790819

View in Genome Browser
Species Human (GRCh38)
Location 16:86232846-86232868
Sequence TTCTATCATCTGGTTGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141790819_1141790826 4 Left 1141790819 16:86232846-86232868 CCAACCCCAACCAGATGATAGAA No data
Right 1141790826 16:86232873-86232895 TATTCCTGGTTCAAACCAGAGGG No data
1141790819_1141790824 -10 Left 1141790819 16:86232846-86232868 CCAACCCCAACCAGATGATAGAA No data
Right 1141790824 16:86232859-86232881 GATGATAGAAAAAATATTCCTGG No data
1141790819_1141790825 3 Left 1141790819 16:86232846-86232868 CCAACCCCAACCAGATGATAGAA No data
Right 1141790825 16:86232872-86232894 ATATTCCTGGTTCAAACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141790819 Original CRISPR TTCTATCATCTGGTTGGGGT TGG (reversed) Intergenic
No off target data available for this crispr